ID: 985046738

View in Genome Browser
Species Human (GRCh38)
Location 4:185948352-185948374
Sequence GGGAGGGCTAATGTATATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985046738 Original CRISPR GGGAGGGCTAATGTATATTA GGG (reversed) Intronic
909253061 1:73382749-73382771 GGGGGGACTATTGTATAATAAGG - Intergenic
909540914 1:76790666-76790688 GGGAGGTCTAATTTAGATTATGG + Intergenic
918669146 1:187191961-187191983 TGGAGGTCTAATGTATAGCATGG + Intergenic
919133777 1:193483446-193483468 TGGAGGCCTAATGTATAGCATGG - Intergenic
922006699 1:221538287-221538309 GGGAGGGGGTATTTATATTATGG - Intergenic
924148323 1:241100712-241100734 GGGTGGGGTAAAGTATTTTAAGG + Intronic
1063237706 10:4135567-4135589 GGGAGGGATAATGTATCTATAGG + Intergenic
1064203849 10:13306194-13306216 GTGAGGGCTAAGGTATGTTAGGG + Intergenic
1070475538 10:76825693-76825715 GAGAGGGCTTATGTATCTTGTGG + Intergenic
1072163711 10:92791387-92791409 TGGAAGCCTAAAGTATATTATGG - Intergenic
1074799799 10:116988085-116988107 GTGAGCCCTAATGTAAATTATGG + Intronic
1075635441 10:124027268-124027290 GGGATGGGAAATGTATGTTAGGG + Intronic
1079387150 11:19990507-19990529 GGGAGGGGGAAGGTATTTTAGGG - Intronic
1089943249 11:122441084-122441106 GGACGGGGTAATGTATATGAAGG + Intergenic
1092653260 12:10656982-10657004 GGGATGGCTAATGGAAGTTATGG + Intronic
1092908749 12:13126172-13126194 GGGAGCCCTAATGTAAACTAGGG - Intronic
1093717106 12:22395409-22395431 AGGAAGGCTACTGTTTATTAGGG - Intronic
1096278747 12:50233366-50233388 GGGAGGGGAAATGTATATGTTGG - Intronic
1099037103 12:77602266-77602288 GAGAGGGCAAATGAATATCAAGG + Intergenic
1101543574 12:105687625-105687647 GGGAGGGCTAAGGGACATAAAGG - Intergenic
1102074499 12:110048967-110048989 GGTAGGGAGAATGTACATTAAGG - Intronic
1107601487 13:42017977-42017999 TGAAGAGCTAATGTATAGTATGG + Intergenic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1109256963 13:60095430-60095452 GGGTGGGTCAATGTAAATTAAGG + Intronic
1111735620 13:92135430-92135452 GGGAGGTCTAATGTAGAGTTTGG + Intronic
1115628803 14:35222625-35222647 GGAAGGGGTAGTATATATTATGG - Intronic
1117810026 14:59536089-59536111 AGGAGTGATAAGGTATATTAGGG - Intronic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1123675221 15:22704106-22704128 GGGAGGTCTAATGTAGAGTTTGG + Intergenic
1124327226 15:28777103-28777125 GGGAGGTCTAATGTAGAGTTTGG + Intergenic
1127882611 15:63171439-63171461 GGAAGGCCTAATGTCCATTAGGG - Intergenic
1129283198 15:74502209-74502231 GGGAGGCAAAATGTTTATTAAGG + Intergenic
1138372468 16:56538128-56538150 GGGAGGGCATATGTATAAGAAGG - Intergenic
1139948519 16:70657875-70657897 GTGAGCCCTAATGTAAATTATGG + Intronic
1142036833 16:87867649-87867671 GGAAGGGCTAATTTATAGTTGGG - Intronic
1142536574 17:621196-621218 GGGAGGTATAATGTCTTTTATGG - Intronic
1143706871 17:8704649-8704671 GGGTTGGCTAATATATATAATGG - Intergenic
1146084718 17:29816786-29816808 GCTAGGCCTAATTTATATTAGGG - Intronic
1149899772 17:60464405-60464427 GGAAGGGGGAATGTATTTTAAGG - Intronic
1153358837 18:4170408-4170430 GGGAGGCCTGATTTATATTATGG + Intronic
1156148028 18:34209544-34209566 AGGAGGGCAAATGGATGTTAGGG - Intronic
1157376538 18:47172443-47172465 GGGAGGACTACTGTAAGTTAAGG - Intronic
1165338382 19:35190757-35190779 GGGAGGGATTATCAATATTAGGG - Intergenic
926506809 2:13726274-13726296 GTGAAGGCTGATGTATTTTAGGG - Intergenic
935784242 2:106534358-106534380 CAGAGGGCTAATTTATTTTAAGG - Intergenic
937944685 2:127322053-127322075 GGGTGGGCTGATGTCCATTACGG + Exonic
939225269 2:139356317-139356339 GGAAGGGCTAATTTTGATTAAGG + Intergenic
939703802 2:145426991-145427013 GGGAGGTCTAATGTACAGCATGG + Intergenic
940686304 2:156855720-156855742 GGAGGGGCTCATGTGTATTAGGG - Intergenic
942111962 2:172691430-172691452 GGGAACTCTAATGTAAATTATGG - Intergenic
943710534 2:191090027-191090049 GTGAGCCCTAATGTAAATTATGG + Intronic
945021378 2:205575393-205575415 GAGAGCGCTAATGTAAACTATGG - Intronic
945355865 2:208838738-208838760 AGTATGGCTAATGTATAGTAAGG - Intronic
946860248 2:223994354-223994376 GGGAGGACTAAGATATAATAAGG + Intronic
1171136955 20:22703296-22703318 GTGAGCCCTAATGTAAATTATGG - Intergenic
1172570708 20:35968166-35968188 GGGCAGGCTAATGCAAATTAAGG + Intronic
1177464266 21:21454950-21454972 GAGAAGGAAAATGTATATTAAGG - Intronic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1178108559 21:29348625-29348647 GGAAGGGGAAATGTAAATTAAGG - Intronic
949785422 3:7735086-7735108 GGGAGGGATTCTTTATATTATGG - Intronic
953822830 3:46222967-46222989 GGGAAGGAGAAAGTATATTAAGG + Intronic
954646350 3:52133932-52133954 GAGAGGGCTACTGCATCTTAGGG - Intronic
958698139 3:97553358-97553380 GGGAGGGCTACTTTAGATTTAGG - Intronic
961335609 3:126177683-126177705 GGGAATTCTAATGTAAATTATGG + Intronic
963083082 3:141412764-141412786 GGGAGGGAGAAAGAATATTAAGG - Intronic
965877599 3:173346346-173346368 AAGAGGCCTATTGTATATTATGG + Intergenic
965976482 3:174630008-174630030 GGGCAGGTTTATGTATATTATGG + Intronic
970405900 4:15764027-15764049 GTGAGCGCTAATGTAAACTATGG + Intergenic
971645339 4:29192727-29192749 CGTATGGCTAATGTAAATTATGG + Intergenic
972323455 4:37993532-37993554 GGGAGTGCTACTGTATGTTGAGG - Intronic
972872349 4:43314972-43314994 AGGTGGGCTAATTTATTTTAGGG + Intergenic
975643984 4:76527956-76527978 GGGAGGGTGAATGGATATTGGGG + Intronic
978196341 4:105976503-105976525 TGCAGGGCTAATGTATAATTAGG + Intronic
978956536 4:114620872-114620894 AGGAGGGTTAATGTATTCTAAGG + Intronic
981196168 4:141923331-141923353 TGGAGAGGTAATGTATAGTATGG - Intergenic
981769329 4:148289441-148289463 AGGAGGCTTAAGGTATATTAAGG - Intronic
985046738 4:185948352-185948374 GGGAGGGCTAATGTATATTAGGG - Intronic
988064400 5:26216941-26216963 GGAAATGGTAATGTATATTATGG - Intergenic
995015460 5:107304284-107304306 CTGAGGGCTTATGTTTATTAGGG - Intergenic
995686208 5:114775284-114775306 TGGAGGTCTAATGTATAGTGTGG - Intergenic
997389005 5:133498067-133498089 GGGGGTGCTAAAGAATATTATGG - Intronic
998518162 5:142774598-142774620 GTGAGCCCTAATGTAAATTATGG - Intronic
1000911189 5:167024531-167024553 GGGAAGGCTATTTTATATTGGGG + Intergenic
1005773544 6:29103238-29103260 TGGAGATCTAATGTAGATTATGG - Intergenic
1008710182 6:54215691-54215713 TGGAGAGCTAATGTATAGCATGG - Intronic
1015231608 6:130921350-130921372 GGGAGTGCTAATGGAGTTTATGG - Intronic
1018956376 6:168413090-168413112 GTGGGGGCTAATGTCTATAAGGG + Intergenic
1027822773 7:83069123-83069145 TGGAGAACTAATGCATATTATGG + Intronic
1030363937 7:108625034-108625056 GGGATGGCTAATAGTTATTATGG - Intergenic
1037234243 8:16697742-16697764 GTGAGCCCTAATGTAAATTATGG + Intergenic
1039218059 8:35295756-35295778 TGGAGAGCTAATGTACATCATGG - Intronic
1041484438 8:58359071-58359093 GGGTGGGGTAGTGTATAATATGG - Intergenic
1042504017 8:69540414-69540436 GGCAGGGCTATTATATTTTATGG + Intronic
1046699644 8:117385532-117385554 GGGAGGAGAAATGTATACTAAGG + Intergenic
1047307215 8:123662627-123662649 GAGAGGGCTAGTGTATAGCATGG - Intergenic
1051995893 9:23217683-23217705 TGGAGACCTAATGTATAGTATGG - Intergenic
1052245041 9:26324225-26324247 GGGAAGGCTAATGTAGAAAAGGG - Intergenic
1052328037 9:27238168-27238190 AGGAGAGCTATTGTATATCATGG + Intergenic
1056930689 9:90874188-90874210 GGGAGGACTAAAGTACATAAAGG - Exonic
1057138388 9:92711180-92711202 GGGAGGGGTCATGTATATGTGGG - Intergenic
1188415758 X:29932008-29932030 GACAGGGCTATTGTATATCAAGG - Intronic
1191743636 X:64463310-64463332 GCTAGGGCTAATGTCTCTTATGG + Intergenic
1197427945 X:126321466-126321488 GGGAGGTATAATGTACAATATGG - Intergenic
1198569669 X:137941559-137941581 TGGAGGGCTAAAGTGGATTATGG + Intergenic
1199210412 X:145202690-145202712 TGGAGGTCTAATGTATAGCATGG + Intergenic