ID: 985052154

View in Genome Browser
Species Human (GRCh38)
Location 4:186001641-186001663
Sequence CATCATACACAGAAGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985052151_985052154 1 Left 985052151 4:186001617-186001639 CCAAAGAAGGATGACTTATGTGC No data
Right 985052154 4:186001641-186001663 CATCATACACAGAAGGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985052154 Original CRISPR CATCATACACAGAAGGTGCT GGG Intergenic
No off target data available for this crispr