ID: 985057936

View in Genome Browser
Species Human (GRCh38)
Location 4:186051311-186051333
Sequence CAGGGAAGACAGGAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985057936_985057946 12 Left 985057936 4:186051311-186051333 CCCTCCTCTTCCTGTCTTCCCTG No data
Right 985057946 4:186051346-186051368 CAGAGCGGCAGAAGACGACGAGG No data
985057936_985057942 -3 Left 985057936 4:186051311-186051333 CCCTCCTCTTCCTGTCTTCCCTG No data
Right 985057942 4:186051331-186051353 CTGCAGCCTGCTTCCCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985057936 Original CRISPR CAGGGAAGACAGGAAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr