ID: 985057942

View in Genome Browser
Species Human (GRCh38)
Location 4:186051331-186051353
Sequence CTGCAGCCTGCTTCCCAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985057929_985057942 17 Left 985057929 4:186051291-186051313 CCCACCCACCGGGTGTCCTCCCC No data
Right 985057942 4:186051331-186051353 CTGCAGCCTGCTTCCCAGAGCGG No data
985057935_985057942 -2 Left 985057935 4:186051310-186051332 CCCCTCCTCTTCCTGTCTTCCCT No data
Right 985057942 4:186051331-186051353 CTGCAGCCTGCTTCCCAGAGCGG No data
985057937_985057942 -4 Left 985057937 4:186051312-186051334 CCTCCTCTTCCTGTCTTCCCTGC No data
Right 985057942 4:186051331-186051353 CTGCAGCCTGCTTCCCAGAGCGG No data
985057936_985057942 -3 Left 985057936 4:186051311-186051333 CCCTCCTCTTCCTGTCTTCCCTG No data
Right 985057942 4:186051331-186051353 CTGCAGCCTGCTTCCCAGAGCGG No data
985057934_985057942 1 Left 985057934 4:186051307-186051329 CCTCCCCTCCTCTTCCTGTCTTC No data
Right 985057942 4:186051331-186051353 CTGCAGCCTGCTTCCCAGAGCGG No data
985057932_985057942 12 Left 985057932 4:186051296-186051318 CCACCGGGTGTCCTCCCCTCCTC No data
Right 985057942 4:186051331-186051353 CTGCAGCCTGCTTCCCAGAGCGG No data
985057933_985057942 9 Left 985057933 4:186051299-186051321 CCGGGTGTCCTCCCCTCCTCTTC No data
Right 985057942 4:186051331-186051353 CTGCAGCCTGCTTCCCAGAGCGG No data
985057930_985057942 16 Left 985057930 4:186051292-186051314 CCACCCACCGGGTGTCCTCCCCT No data
Right 985057942 4:186051331-186051353 CTGCAGCCTGCTTCCCAGAGCGG No data
985057938_985057942 -7 Left 985057938 4:186051315-186051337 CCTCTTCCTGTCTTCCCTGCAGC No data
Right 985057942 4:186051331-186051353 CTGCAGCCTGCTTCCCAGAGCGG No data
985057931_985057942 13 Left 985057931 4:186051295-186051317 CCCACCGGGTGTCCTCCCCTCCT No data
Right 985057942 4:186051331-186051353 CTGCAGCCTGCTTCCCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985057942 Original CRISPR CTGCAGCCTGCTTCCCAGAG CGG Intergenic
No off target data available for this crispr