ID: 985057946

View in Genome Browser
Species Human (GRCh38)
Location 4:186051346-186051368
Sequence CAGAGCGGCAGAAGACGACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985057938_985057946 8 Left 985057938 4:186051315-186051337 CCTCTTCCTGTCTTCCCTGCAGC No data
Right 985057946 4:186051346-186051368 CAGAGCGGCAGAAGACGACGAGG No data
985057941_985057946 -7 Left 985057941 4:186051330-186051352 CCTGCAGCCTGCTTCCCAGAGCG No data
Right 985057946 4:186051346-186051368 CAGAGCGGCAGAAGACGACGAGG No data
985057931_985057946 28 Left 985057931 4:186051295-186051317 CCCACCGGGTGTCCTCCCCTCCT No data
Right 985057946 4:186051346-186051368 CAGAGCGGCAGAAGACGACGAGG No data
985057932_985057946 27 Left 985057932 4:186051296-186051318 CCACCGGGTGTCCTCCCCTCCTC No data
Right 985057946 4:186051346-186051368 CAGAGCGGCAGAAGACGACGAGG No data
985057935_985057946 13 Left 985057935 4:186051310-186051332 CCCCTCCTCTTCCTGTCTTCCCT No data
Right 985057946 4:186051346-186051368 CAGAGCGGCAGAAGACGACGAGG No data
985057934_985057946 16 Left 985057934 4:186051307-186051329 CCTCCCCTCCTCTTCCTGTCTTC No data
Right 985057946 4:186051346-186051368 CAGAGCGGCAGAAGACGACGAGG No data
985057937_985057946 11 Left 985057937 4:186051312-186051334 CCTCCTCTTCCTGTCTTCCCTGC No data
Right 985057946 4:186051346-186051368 CAGAGCGGCAGAAGACGACGAGG No data
985057936_985057946 12 Left 985057936 4:186051311-186051333 CCCTCCTCTTCCTGTCTTCCCTG No data
Right 985057946 4:186051346-186051368 CAGAGCGGCAGAAGACGACGAGG No data
985057933_985057946 24 Left 985057933 4:186051299-186051321 CCGGGTGTCCTCCCCTCCTCTTC No data
Right 985057946 4:186051346-186051368 CAGAGCGGCAGAAGACGACGAGG No data
985057940_985057946 -6 Left 985057940 4:186051329-186051351 CCCTGCAGCCTGCTTCCCAGAGC No data
Right 985057946 4:186051346-186051368 CAGAGCGGCAGAAGACGACGAGG No data
985057939_985057946 2 Left 985057939 4:186051321-186051343 CCTGTCTTCCCTGCAGCCTGCTT No data
Right 985057946 4:186051346-186051368 CAGAGCGGCAGAAGACGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985057946 Original CRISPR CAGAGCGGCAGAAGACGACG AGG Intergenic
No off target data available for this crispr