ID: 985058281

View in Genome Browser
Species Human (GRCh38)
Location 4:186054906-186054928
Sequence GAGTATCCATAGGCCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985058281_985058287 3 Left 985058281 4:186054906-186054928 CCAGCCTGGGCCTATGGATACTC No data
Right 985058287 4:186054932-186054954 GGGAAACACTACGTTGCTCATGG No data
985058281_985058288 16 Left 985058281 4:186054906-186054928 CCAGCCTGGGCCTATGGATACTC No data
Right 985058288 4:186054945-186054967 TTGCTCATGGAATGCAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985058281 Original CRISPR GAGTATCCATAGGCCCAGGC TGG (reversed) Intergenic
No off target data available for this crispr