ID: 985062481

View in Genome Browser
Species Human (GRCh38)
Location 4:186092873-186092895
Sequence CCACGCAGAGGCCTGTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985062481_985062489 15 Left 985062481 4:186092873-186092895 CCTCAGGACAGGCCTCTGCGTGG No data
Right 985062489 4:186092911-186092933 ATGTCCACGTTTGTGGCCATGGG No data
985062481_985062495 30 Left 985062481 4:186092873-186092895 CCTCAGGACAGGCCTCTGCGTGG No data
Right 985062495 4:186092926-186092948 GCCATGGGAGTAGGGTGCCGGGG No data
985062481_985062493 28 Left 985062481 4:186092873-186092895 CCTCAGGACAGGCCTCTGCGTGG No data
Right 985062493 4:186092924-186092946 TGGCCATGGGAGTAGGGTGCCGG No data
985062481_985062491 21 Left 985062481 4:186092873-186092895 CCTCAGGACAGGCCTCTGCGTGG No data
Right 985062491 4:186092917-186092939 ACGTTTGTGGCCATGGGAGTAGG No data
985062481_985062494 29 Left 985062481 4:186092873-186092895 CCTCAGGACAGGCCTCTGCGTGG No data
Right 985062494 4:186092925-186092947 GGCCATGGGAGTAGGGTGCCGGG No data
985062481_985062487 8 Left 985062481 4:186092873-186092895 CCTCAGGACAGGCCTCTGCGTGG No data
Right 985062487 4:186092904-186092926 GGGATAGATGTCCACGTTTGTGG No data
985062481_985062488 14 Left 985062481 4:186092873-186092895 CCTCAGGACAGGCCTCTGCGTGG No data
Right 985062488 4:186092910-186092932 GATGTCCACGTTTGTGGCCATGG No data
985062481_985062492 22 Left 985062481 4:186092873-186092895 CCTCAGGACAGGCCTCTGCGTGG No data
Right 985062492 4:186092918-186092940 CGTTTGTGGCCATGGGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985062481 Original CRISPR CCACGCAGAGGCCTGTCCTG AGG (reversed) Intergenic
No off target data available for this crispr