ID: 985062486

View in Genome Browser
Species Human (GRCh38)
Location 4:186092885-186092907
Sequence TCCCCAGCTAGACCACGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985062486_985062497 22 Left 985062486 4:186092885-186092907 CCTCTGCGTGGTCTAGCTGGGGA No data
Right 985062497 4:186092930-186092952 TGGGAGTAGGGTGCCGGGGTTGG No data
985062486_985062495 18 Left 985062486 4:186092885-186092907 CCTCTGCGTGGTCTAGCTGGGGA No data
Right 985062495 4:186092926-186092948 GCCATGGGAGTAGGGTGCCGGGG No data
985062486_985062493 16 Left 985062486 4:186092885-186092907 CCTCTGCGTGGTCTAGCTGGGGA No data
Right 985062493 4:186092924-186092946 TGGCCATGGGAGTAGGGTGCCGG No data
985062486_985062491 9 Left 985062486 4:186092885-186092907 CCTCTGCGTGGTCTAGCTGGGGA No data
Right 985062491 4:186092917-186092939 ACGTTTGTGGCCATGGGAGTAGG No data
985062486_985062488 2 Left 985062486 4:186092885-186092907 CCTCTGCGTGGTCTAGCTGGGGA No data
Right 985062488 4:186092910-186092932 GATGTCCACGTTTGTGGCCATGG No data
985062486_985062489 3 Left 985062486 4:186092885-186092907 CCTCTGCGTGGTCTAGCTGGGGA No data
Right 985062489 4:186092911-186092933 ATGTCCACGTTTGTGGCCATGGG No data
985062486_985062492 10 Left 985062486 4:186092885-186092907 CCTCTGCGTGGTCTAGCTGGGGA No data
Right 985062492 4:186092918-186092940 CGTTTGTGGCCATGGGAGTAGGG No data
985062486_985062494 17 Left 985062486 4:186092885-186092907 CCTCTGCGTGGTCTAGCTGGGGA No data
Right 985062494 4:186092925-186092947 GGCCATGGGAGTAGGGTGCCGGG No data
985062486_985062487 -4 Left 985062486 4:186092885-186092907 CCTCTGCGTGGTCTAGCTGGGGA No data
Right 985062487 4:186092904-186092926 GGGATAGATGTCCACGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985062486 Original CRISPR TCCCCAGCTAGACCACGCAG AGG (reversed) Intergenic
No off target data available for this crispr