ID: 985062494

View in Genome Browser
Species Human (GRCh38)
Location 4:186092925-186092947
Sequence GGCCATGGGAGTAGGGTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985062481_985062494 29 Left 985062481 4:186092873-186092895 CCTCAGGACAGGCCTCTGCGTGG No data
Right 985062494 4:186092925-186092947 GGCCATGGGAGTAGGGTGCCGGG No data
985062486_985062494 17 Left 985062486 4:186092885-186092907 CCTCTGCGTGGTCTAGCTGGGGA No data
Right 985062494 4:186092925-186092947 GGCCATGGGAGTAGGGTGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985062494 Original CRISPR GGCCATGGGAGTAGGGTGCC GGG Intergenic
No off target data available for this crispr