ID: 985064115

View in Genome Browser
Species Human (GRCh38)
Location 4:186104898-186104920
Sequence GAAGGGCGACCCCAGCGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985064101_985064115 15 Left 985064101 4:186104860-186104882 CCGCAGCCGGGGCGCTCGGCGGA No data
Right 985064115 4:186104898-186104920 GAAGGGCGACCCCAGCGGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 85
985064103_985064115 9 Left 985064103 4:186104866-186104888 CCGGGGCGCTCGGCGGACGGACC 0: 1
1: 0
2: 0
3: 7
4: 64
Right 985064115 4:186104898-186104920 GAAGGGCGACCCCAGCGGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985064115 Original CRISPR GAAGGGCGACCCCAGCGGCG CGG Intronic