ID: 985064115

View in Genome Browser
Species Human (GRCh38)
Location 4:186104898-186104920
Sequence GAAGGGCGACCCCAGCGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985064103_985064115 9 Left 985064103 4:186104866-186104888 CCGGGGCGCTCGGCGGACGGACC 0: 1
1: 0
2: 0
3: 7
4: 64
Right 985064115 4:186104898-186104920 GAAGGGCGACCCCAGCGGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 85
985064101_985064115 15 Left 985064101 4:186104860-186104882 CCGCAGCCGGGGCGCTCGGCGGA 0: 1
1: 0
2: 0
3: 6
4: 76
Right 985064115 4:186104898-186104920 GAAGGGCGACCCCAGCGGCGCGG 0: 1
1: 0
2: 0
3: 9
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985064115 Original CRISPR GAAGGGCGACCCCAGCGGCG CGG Intronic
902051347 1:13565897-13565919 GAATGGTGAACCCAGCGGGGAGG - Intergenic
905959987 1:42035611-42035633 GACGGGGGACCCCAGCTGAGGGG + Intronic
912505020 1:110150476-110150498 GAAAGGCCACCCTGGCGGCGGGG - Exonic
922794502 1:228333399-228333421 GAAAGGAGACCCCAGCAGCGGGG + Intronic
1077386200 11:2270638-2270660 GAAAGGCGACGGCGGCGGCGCGG - Exonic
1079091658 11:17484976-17484998 GAAGAGCAACCCCAGCAGTGTGG + Intergenic
1079128441 11:17734614-17734636 GGCGGGCGCCCCCAGCGCCGAGG + Intergenic
1083658443 11:64241382-64241404 GAAGGCGGAGCCCGGCGGCGGGG + Intronic
1105207135 13:18234130-18234152 GGACGGCGACCCCGTCGGCGAGG - Intergenic
1105295582 13:19085873-19085895 GAACGGTGACCCCAGCAGTGTGG + Intergenic
1106468891 13:30037471-30037493 GAAGGGGGACCCCAGGCGGGAGG - Intergenic
1114477409 14:23006747-23006769 GAAAGGCGATCGCAGCGACGCGG + Intronic
1115592011 14:34874211-34874233 GGAGGGCGACAGCAGCGGCTAGG + Intronic
1117802983 14:59464396-59464418 GAAGGCCGCGCCCAGCTGCGCGG + Exonic
1118610191 14:67533526-67533548 GAAGCGAGCTCCCAGCGGCGGGG + Intronic
1119309447 14:73634014-73634036 GGAGGGGGACCCCAGAGGCTCGG - Intergenic
1119438481 14:74612667-74612689 GGAGGGCGCCCCCAGCGGCCAGG - Intergenic
1120521914 14:85534026-85534048 GAAGCGGGAGCGCAGCGGCGGGG - Intronic
1121249492 14:92489057-92489079 GAAGGGTGAGGCCAGGGGCGGGG + Intronic
1121548254 14:94778935-94778957 GAAGGGCTAGCCCAGAAGCGAGG + Intergenic
1122221167 14:100239790-100239812 GAAGAGTTACCTCAGCGGCGGGG + Exonic
1122486644 14:102086703-102086725 GGCGGGGGACCCCCGCGGCGGGG + Intronic
1122556003 14:102580443-102580465 GAAGGGAGAGCCCAGGGGTGGGG + Intergenic
1126451120 15:48810709-48810731 TCAGGGCGACCCCAGCAGCCTGG + Intronic
1132143835 15:99415212-99415234 GCAGGGCCACCCCAGCTCCGGGG + Intergenic
1132740318 16:1408738-1408760 GAAAGGAGACGCCAGCAGCGGGG + Intronic
1132851670 16:2027440-2027462 AAAGGGCGAGGCCAGCGGCCAGG - Intronic
1135191945 16:20361668-20361690 GAAGGGTGACCCCAGCACTGTGG - Intronic
1138961578 16:62035552-62035574 GGAGGGCGACCCCCGCGGCAGGG - Intronic
1139754571 16:69132333-69132355 GAATGGCGAGCCGAGGGGCGGGG - Intronic
1139954802 16:70687965-70687987 GAAGTGCGGCACCAGCGGAGCGG - Exonic
1139957742 16:70701152-70701174 GAAGGGCTACCCCAGCCCTGGGG - Intronic
1141445452 16:84055095-84055117 GAAGGGCTTTCCCAGAGGCGGGG - Intronic
1142234718 16:88916618-88916640 GAAGGGCGGCCCCTGGGGAGAGG + Intronic
1142254252 16:89006399-89006421 GCAGGGCGACCCCAAGGGCAGGG + Intergenic
1150797148 17:68247730-68247752 CACGGGAGACCCCAGCGACGCGG + Exonic
1152103011 17:78313939-78313961 GAAGGGAGCCCGGAGCGGCGCGG + Intergenic
1159897801 18:74013218-74013240 GCAGGGCGACCCCATAGGCAAGG + Intergenic
1160791633 19:926145-926167 GCAGGCCGACCCCAGGCGCGGGG + Intronic
1162199367 19:9009669-9009691 GAAGGGCGTTCCCGGCAGCGGGG - Intergenic
1162744863 19:12792532-12792554 GATGGGGGACACCGGCGGCGTGG - Exonic
1163250781 19:16125222-16125244 GAAGGGTCACCTCAGCGGCCCGG + Intronic
1163714991 19:18868364-18868386 GAAGGGCGACCCCTGCCCCTGGG + Intergenic
1164958404 19:32405992-32406014 GAGGGGCGGCCCCAGGGGCTCGG - Intronic
1168489339 19:56795269-56795291 GAAAAGCCACCCCAGAGGCGAGG - Intronic
926297956 2:11582131-11582153 GAAGGGAGGCCGCAGCAGCGTGG - Intronic
932434640 2:71695813-71695835 GAAAGGCAACCCCAGCCACGTGG + Intergenic
937765729 2:125658703-125658725 AAAGGGCGACCTCAGCAGAGAGG + Intergenic
937986919 2:127642111-127642133 GATGGGCGTCCCCATCTGCGGGG - Exonic
938058263 2:128233124-128233146 GAAGGCCGAGCCCGGCGGCGCGG + Intergenic
942451017 2:176107982-176108004 CAAGGGCGACCCCAGGACCGGGG + Exonic
944884821 2:204051716-204051738 GAAGAGCGGCCCCAGCTGCATGG - Intergenic
948066977 2:235088073-235088095 GAAAGGCTGCCCCACCGGCGGGG - Intergenic
948487358 2:238289217-238289239 GAGGCGCGCCCCCAGCGGCCAGG + Intronic
1171201660 20:23246871-23246893 GAAGGGCAACCCCACCCCCGTGG + Intergenic
1172361078 20:34312793-34312815 CAAGGGCGACTCCAGCTGCAGGG - Intergenic
1173576585 20:44116117-44116139 GAACGGCGAGCCCAGCGGTGAGG - Exonic
1173812347 20:45963768-45963790 GAAGGTCGACCTCGGCGCCGGGG + Exonic
1178680567 21:34669739-34669761 GCAGGGCGAGCCCCGCGGGGAGG + Exonic
1179629554 21:42668052-42668074 AAAGGGACACCCCAGCGGGGAGG - Intronic
1181594780 22:23907052-23907074 GCTGGGCTACCCCAGCAGCGGGG + Intergenic
950008002 3:9703920-9703942 TAGGGGCGACGGCAGCGGCGGGG - Exonic
950480461 3:13240493-13240515 CAAGGGAGACACCAGCGGTGTGG + Intergenic
965335622 3:167428443-167428465 GAATGGCGAACCCAGTGGGGAGG - Intergenic
966292962 3:178382020-178382042 GAAGGGACACCCCAGCTGCTGGG - Intergenic
968483120 4:845613-845635 GAAGGCCAACCCCAGAGGTGTGG - Intergenic
968534259 4:1113469-1113491 GGCGGGCGACCGCAGCGGCGAGG + Exonic
974549088 4:63349115-63349137 GAAGGGCGGCCCCAGAGGATGGG - Intergenic
975689399 4:76949573-76949595 GAGGGGCGAGCCCCGCGGCCGGG + Intergenic
985064115 4:186104898-186104920 GAAGGGCGACCCCAGCGGCGCGG + Intronic
986130279 5:4923661-4923683 GAAGGGAGACCCCACAGGCTTGG + Intergenic
1001605875 5:172959339-172959361 GAATGGCGCCCCCAGCGGCTTGG - Intronic
1001823087 5:174724934-174724956 GAAGGGCTTCACCAGCGGCCCGG - Exonic
1002561709 5:180086999-180087021 GAAGTGCAAGCCCAGCGGGGAGG - Intergenic
1003624081 6:7727026-7727048 CAAGGGCGGCCGCAGCGGCGGGG - Exonic
1004615051 6:17281448-17281470 CAAGGGCGAGCCCGGGGGCGAGG - Exonic
1007518188 6:42430000-42430022 GAAGAGCAACCCCAGCAGAGAGG + Intronic
1015403761 6:132814778-132814800 GAAGGGTGAGCCCAGGGGCCGGG + Exonic
1026740656 7:72976427-72976449 GAAGGGCGAAACCTGAGGCGGGG + Intergenic
1027103076 7:75388644-75388666 GAAGGGCGAAACCTGAGGCGGGG - Intergenic
1029445820 7:100612435-100612457 AAGGGGCGAGGCCAGCGGCGGGG + Intronic
1030626948 7:111854830-111854852 GAAGGGAAACCCCAGAGGCCAGG - Intronic
1032266710 7:130374692-130374714 TATGGGCCACCCCAGCAGCGTGG - Intergenic
1034859720 7:154584595-154584617 GATGGGCGTCCCGAGCGACGTGG - Intronic
1034938479 7:155214808-155214830 GCAGGGAGACCCCAGCAGAGTGG + Intergenic
1035259147 7:157650553-157650575 GAACGGCCAGCCCAGCCGCGTGG + Intronic
1039554701 8:38467791-38467813 GAGGGGAGACCCAAGGGGCGCGG + Exonic
1048833377 8:138497068-138497090 GAGGCGCCAGCCCAGCGGCGCGG - Intergenic
1049641077 8:143716289-143716311 GAGGGGCGCCCCGAGGGGCGGGG + Exonic
1049743234 8:144250912-144250934 GAAGGGGGACCCCAGTGGGCTGG - Intronic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic
1060404993 9:123368690-123368712 GAGGGGGGACCCCAGCTGCAGGG + Intronic
1062623498 9:137433076-137433098 TATGGGCGTCCTCAGCGGCGGGG + Intronic
1188004083 X:25005488-25005510 GAAGGGCGGCCGCGGCGGCGCGG - Intronic
1190803503 X:53813838-53813860 GAAGGGTACCCCCAGCAGCGCGG - Intergenic