ID: 985064338

View in Genome Browser
Species Human (GRCh38)
Location 4:186105580-186105602
Sequence CGCCGATGTCAGGCAGCGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985064338_985064351 11 Left 985064338 4:186105580-186105602 CCTTACGCTGCCTGACATCGGCG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 985064351 4:186105614-186105636 TCGGACGGCGACTCCGGGGATGG 0: 1
1: 0
2: 1
3: 1
4: 30
985064338_985064348 6 Left 985064338 4:186105580-186105602 CCTTACGCTGCCTGACATCGGCG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 985064348 4:186105609-186105631 GGGCCTCGGACGGCGACTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 112
985064338_985064346 -4 Left 985064338 4:186105580-186105602 CCTTACGCTGCCTGACATCGGCG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 985064346 4:186105599-186105621 GGCGAGGAGGGGGCCTCGGACGG 0: 1
1: 0
2: 3
3: 43
4: 421
985064338_985064345 -8 Left 985064338 4:186105580-186105602 CCTTACGCTGCCTGACATCGGCG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 985064345 4:186105595-186105617 CATCGGCGAGGAGGGGGCCTCGG 0: 1
1: 0
2: 0
3: 16
4: 141
985064338_985064347 5 Left 985064338 4:186105580-186105602 CCTTACGCTGCCTGACATCGGCG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 985064347 4:186105608-186105630 GGGGCCTCGGACGGCGACTCCGG 0: 1
1: 0
2: 0
3: 7
4: 119
985064338_985064349 7 Left 985064338 4:186105580-186105602 CCTTACGCTGCCTGACATCGGCG 0: 1
1: 0
2: 0
3: 1
4: 24
Right 985064349 4:186105610-186105632 GGCCTCGGACGGCGACTCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985064338 Original CRISPR CGCCGATGTCAGGCAGCGTA AGG (reversed) Intronic
903781948 1:25826349-25826371 AGGCGATGTCAGCCAGGGTAGGG - Exonic
910133505 1:83937680-83937702 CGCTGTTGTTAGGCAGCGTGTGG + Intronic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
915932669 1:160069906-160069928 CGCTGAGGCCAGGCAGGGTAGGG + Intronic
1063197951 10:3760382-3760404 TGCCCATGTCAGGCAGAGGATGG + Intergenic
1075644441 10:124088265-124088287 CGCCGTTGACAGGCACCTTATGG - Intronic
1083471734 11:62888679-62888701 GGCTGAAGTCAGGCCGCGTAGGG - Exonic
1090708992 11:129369173-129369195 CTCCCATGTCAGGCAGCACAGGG - Intergenic
1124846239 15:33293875-33293897 CACCGATTTCAGGCAGCGATAGG - Intergenic
1142477724 17:199479-199501 CGCCGCGGTCAGGCAGTGTGGGG + Intergenic
1143099907 17:4499220-4499242 AGACGCTGTCGGGCAGCGTAAGG + Exonic
1153886984 18:9475779-9475801 CGCGTCTGTCAGGCAGCGTGTGG + Intronic
941939980 2:171024839-171024861 TGCCTGTGTCAGGCAGAGTATGG + Intronic
1169652777 20:7888220-7888242 CACTAATGTCAGGCAGAGTAAGG + Intronic
1178850906 21:36211372-36211394 CTCCGATGTCACGCAGCCTGTGG + Intronic
960640040 3:119815451-119815473 GGGGGATGTCAGGCAGCCTAGGG - Intronic
973713197 4:53649750-53649772 CTCCGATGGCAGGCTGTGTAGGG + Intronic
985064338 4:186105580-186105602 CGCCGATGTCAGGCAGCGTAAGG - Intronic
997628650 5:135349350-135349372 CTCCAAAGTCAGGCAGCTTAAGG - Intronic
997899854 5:137754405-137754427 CGCCGACGTACGGCAGCCTAGGG + Intergenic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1014791206 6:125674429-125674451 CGCTGGAGTGAGGCAGCGTATGG + Intergenic
1018317259 6:162569281-162569303 CGCAGATGTCAAGCAGCGTGGGG + Intronic
1062250560 9:135591762-135591784 CTCCGAGGTCAGGCAGAGTTTGG - Intergenic
1187106663 X:16250220-16250242 AGCCAATGACAGGCAACGTAGGG + Intergenic
1189893788 X:45632712-45632734 CGCAGATGCCAAGCAGCGTGGGG - Intergenic