ID: 985064343

View in Genome Browser
Species Human (GRCh38)
Location 4:186105589-186105611
Sequence GCCTGACATCGGCGAGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985064333_985064343 0 Left 985064333 4:186105566-186105588 CCCAGAACCCTGTTCCTTACGCT 0: 1
1: 0
2: 0
3: 6
4: 82
Right 985064343 4:186105589-186105611 GCCTGACATCGGCGAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 103
985064329_985064343 13 Left 985064329 4:186105553-186105575 CCCCGGGGCTGGCCCCAGAACCC 0: 1
1: 0
2: 6
3: 38
4: 375
Right 985064343 4:186105589-186105611 GCCTGACATCGGCGAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 103
985064331_985064343 11 Left 985064331 4:186105555-186105577 CCGGGGCTGGCCCCAGAACCCTG 0: 1
1: 0
2: 8
3: 65
4: 766
Right 985064343 4:186105589-186105611 GCCTGACATCGGCGAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 103
985064330_985064343 12 Left 985064330 4:186105554-186105576 CCCGGGGCTGGCCCCAGAACCCT 0: 1
1: 0
2: 6
3: 36
4: 451
Right 985064343 4:186105589-186105611 GCCTGACATCGGCGAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 103
985064332_985064343 1 Left 985064332 4:186105565-186105587 CCCCAGAACCCTGTTCCTTACGC 0: 1
1: 0
2: 0
3: 7
4: 95
Right 985064343 4:186105589-186105611 GCCTGACATCGGCGAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 103
985064327_985064343 23 Left 985064327 4:186105543-186105565 CCTGCGTGGCCCCCGGGGCTGGC 0: 1
1: 0
2: 0
3: 27
4: 303
Right 985064343 4:186105589-186105611 GCCTGACATCGGCGAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 103
985064336_985064343 -8 Left 985064336 4:186105574-186105596 CCTGTTCCTTACGCTGCCTGACA 0: 1
1: 0
2: 0
3: 5
4: 100
Right 985064343 4:186105589-186105611 GCCTGACATCGGCGAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 103
985064334_985064343 -1 Left 985064334 4:186105567-186105589 CCAGAACCCTGTTCCTTACGCTG 0: 1
1: 0
2: 0
3: 8
4: 95
Right 985064343 4:186105589-186105611 GCCTGACATCGGCGAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 103
985064335_985064343 -7 Left 985064335 4:186105573-186105595 CCCTGTTCCTTACGCTGCCTGAC 0: 1
1: 0
2: 0
3: 3
4: 98
Right 985064343 4:186105589-186105611 GCCTGACATCGGCGAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 103
985064328_985064343 14 Left 985064328 4:186105552-186105574 CCCCCGGGGCTGGCCCCAGAACC 0: 1
1: 0
2: 1
3: 42
4: 468
Right 985064343 4:186105589-186105611 GCCTGACATCGGCGAGGAGGGGG 0: 1
1: 0
2: 0
3: 7
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985064343 Original CRISPR GCCTGACATCGGCGAGGAGG GGG Intronic
900180660 1:1309614-1309636 CCCTGACAGCGGGGAGGGGGCGG + Intronic
901459751 1:9384457-9384479 GCTTGGCATGGGAGAGGAGGAGG - Intergenic
901733719 1:11298857-11298879 TCCTGACGGAGGCGAGGAGGAGG + Intergenic
904910005 1:33927689-33927711 TCCTGACATGGGCTAGGAGCAGG + Intronic
909348555 1:74621766-74621788 GCCTGACCTCTACGAGGAAGAGG + Intronic
924475393 1:244378242-244378264 ACCTGTCATTGGAGAGGAGGAGG + Intronic
1074882759 10:117671494-117671516 GTCTCACATAGGGGAGGAGGGGG - Intergenic
1075249289 10:120851311-120851333 ACCTGACAGCGGCGCCGAGGGGG + Exonic
1076236270 10:128865575-128865597 GCCTGACATCGGCTGTGAGCAGG - Intergenic
1080497047 11:32830189-32830211 GCAGGACCTCGGCGGGGAGGGGG + Intronic
1082632406 11:55557948-55557970 GCCTGACATAGGCGTGGTGTGGG - Intergenic
1083622913 11:64057734-64057756 GCCTGACATGGCCCAGGAGGAGG + Intronic
1085640243 11:78188789-78188811 GCCGGACACCGGCGGGGACGAGG - Exonic
1090854680 11:130601273-130601295 GCATGAAATCAGAGAGGAGGAGG + Intergenic
1097107958 12:56636170-56636192 GCCTGACATGGGTGAGTATGGGG - Exonic
1101998544 12:109542211-109542233 GTCTGCCATGGGTGAGGAGGAGG - Intergenic
1102122092 12:110449854-110449876 GCCTGACCCCGGGGCGGAGGAGG + Intronic
1102482288 12:113232222-113232244 GCCAGGCATCGGCGTGAAGGAGG - Intronic
1103521279 12:121538027-121538049 GCCTGGCAGCGCCGTGGAGGGGG - Intronic
1103921691 12:124402642-124402664 GCCTGAGCTGGGGGAGGAGGAGG + Intronic
1108436408 13:50405663-50405685 GGATGACATGGGTGAGGAGGAGG - Intronic
1109764907 13:66882333-66882355 GCCTGGCATTGGAGAGGAAGAGG - Intronic
1111282445 13:86044545-86044567 GCCTGTCATGGGCTAGGGGGTGG + Intergenic
1114268523 14:21087408-21087430 GCCTGCCCGCGTCGAGGAGGAGG + Exonic
1114637410 14:24195628-24195650 GCCCGTCTTCGGCGAGGCGGGGG + Intronic
1116950142 14:50872058-50872080 GCCTGACCGCGCGGAGGAGGAGG + Intronic
1118322662 14:64762476-64762498 GCCAGACACCGGCCAAGAGGTGG + Intronic
1121442578 14:93958146-93958168 GCGTGACAGCGGCGAGGATGAGG - Intronic
1128397220 15:67240391-67240413 GGCTGGCATCGACCAGGAGGAGG - Intronic
1130335068 15:82951641-82951663 GCCTGACGTGGGCATGGAGGCGG - Intronic
1131889706 15:96959466-96959488 CACTGACATCGGCAAGAAGGAGG - Intergenic
1133732768 16:8590482-8590504 GCTTTTCCTCGGCGAGGAGGAGG - Intergenic
1134627825 16:15735427-15735449 GCGAGACCTCGGCGAGGAGCTGG - Exonic
1136410770 16:30075873-30075895 GCCTGAGATCGGGAAGGAGGTGG - Intergenic
1140753342 16:78045978-78046000 GCCGGACAGCGGCGAGGCGCTGG + Intronic
1141307694 16:82881758-82881780 GCCTGACAGTGGTGAGGAGGAGG + Intronic
1141697060 16:85625136-85625158 GCCTGGCCTCGGCAGGGAGGCGG - Intronic
1141986336 16:87582739-87582761 GCCTGGCCTCGGAGGGGAGGGGG - Intergenic
1143709168 17:8721996-8722018 GCCAGACAATGGCAAGGAGGAGG - Intergenic
1145105202 17:20109711-20109733 TCATGACATAGGCCAGGAGGAGG - Intronic
1146549564 17:33768826-33768848 GCCTGACTTCAGGGAGGAGATGG + Intronic
1151165205 17:72197611-72197633 GCCTGACATTGGGGGGTAGGGGG + Intergenic
1152081603 17:78190892-78190914 GCCGGGCATGGGCGAGGGGGAGG + Intronic
1154173424 18:12067148-12067170 GCCTGACACCGCCCTGGAGGGGG + Intergenic
1159569697 18:70098792-70098814 GCCTGTCATGGGGTAGGAGGAGG - Intronic
1159890036 18:73944205-73944227 GCATGACAACGGTGGGGAGGGGG - Intergenic
1160525196 18:79531712-79531734 GGCTGACAATGGCCAGGAGGTGG - Intergenic
1160577370 18:79864264-79864286 GCCGGACATCCGCGCCGAGGAGG + Exonic
1161196042 19:2987327-2987349 CCATGACAACGGAGAGGAGGAGG - Intronic
1161301149 19:3543775-3543797 GCTGGCCAACGGCGAGGAGGTGG + Intronic
1165089221 19:33373917-33373939 CCCTGAGAACGGGGAGGAGGAGG + Intronic
1165319589 19:35076979-35077001 TCCTGGCATCTGCGTGGAGGTGG + Intergenic
926347160 2:11957751-11957773 GACTGACATGGGAGAGGAGGAGG + Intergenic
926692821 2:15748910-15748932 GCCTTACAGCAGCCAGGAGGGGG - Intergenic
929604720 2:43226722-43226744 GCCTGACGTCCGCGAGCGGGCGG - Intergenic
934870574 2:97861378-97861400 GCTTGACAGAGGAGAGGAGGGGG + Intronic
936011765 2:108929563-108929585 GCCTGAGAGTGGCGAGGAGAGGG - Intronic
936872584 2:117150230-117150252 ACCTGAAATAGGCAAGGAGGAGG + Intergenic
939488670 2:142849987-142850009 GCCTGACACAGGGAAGGAGGAGG - Intergenic
942854259 2:180526864-180526886 GCCTGTCATGGGTGAGGAGAGGG - Intergenic
949045404 2:241870489-241870511 GCCGGGCATCTGCGAGGATGTGG - Intronic
1170704772 20:18735444-18735466 GCCTGACAGCTGCCTGGAGGTGG + Intronic
1170756866 20:19212671-19212693 GACGGGCAGCGGCGAGGAGGAGG + Exonic
1172883666 20:38217473-38217495 GCCTGAGAGGGGAGAGGAGGGGG + Exonic
1175630090 20:60528464-60528486 GTCTGTCCTCGGGGAGGAGGTGG - Intergenic
1177376192 21:20273798-20273820 GCCTGACAGAGGGTAGGAGGAGG - Intergenic
1179823638 21:43951830-43951852 GCCTGGCAGCGGTGCGGAGGTGG + Intronic
1184355530 22:43977078-43977100 GCCTGTAATAGGCCAGGAGGAGG + Intronic
1185398479 22:50604313-50604335 GCCGGACCTCAGCGAGGACGCGG + Exonic
954803291 3:53199997-53200019 GCCTGGCATGTGCCAGGAGGTGG + Intergenic
955350907 3:58192234-58192256 GCCTGACCTCAGAGAGGAGGGGG + Intergenic
955469675 3:59273546-59273568 ACCTGACATCTGTGAGGAAGAGG - Intergenic
961932072 3:130545429-130545451 GCCTGAAAGCAGCCAGGAGGTGG - Intergenic
962580174 3:136790991-136791013 CCCTGACAGCTGCGAGGAGATGG - Intergenic
967141244 3:186562510-186562532 GACTGACAAGGGCTAGGAGGAGG + Intronic
967891440 3:194366974-194366996 GCCTGGGATTGGGGAGGAGGTGG + Intronic
973898803 4:55445458-55445480 GCCTGGCATGGGGGAAGAGGAGG + Intronic
974979202 4:68933100-68933122 GACTGACATCAGCGAGATGGTGG + Intronic
977803589 4:101269142-101269164 GCCTGTCATAGACGATGAGGAGG - Intronic
978636874 4:110820542-110820564 GCCTGATGTAGGCGGGGAGGGGG - Intergenic
981529764 4:145741042-145741064 GCCTGACCTTTGTGAGGAGGAGG - Intronic
983807931 4:172018211-172018233 GCCTTACATTGGCCAGGGGGAGG + Intronic
985064343 4:186105589-186105611 GCCTGACATCGGCGAGGAGGGGG + Intronic
990893567 5:60673386-60673408 GCCTGAGAAAGGAGAGGAGGAGG + Intronic
991651436 5:68858956-68858978 GCCTGACATGGGCAAAGAGAGGG - Intergenic
992779432 5:80114569-80114591 GCTTGACATCTGGGAGGTGGAGG + Intronic
1001483840 5:172105921-172105943 CCCAGACATCGGCGAGGAGCAGG + Intronic
1006908109 6:37546347-37546369 GCCTCACCCCGGGGAGGAGGAGG - Intergenic
1008299299 6:49814736-49814758 GCCTGAGATGTGGGAGGAGGTGG - Intergenic
1018027481 6:159817383-159817405 TCCTGACATCTGCGGGGATGAGG - Intronic
1019271126 7:149840-149862 GCCTGGCCTCGGCGGGGACGCGG + Intergenic
1020258391 7:6515698-6515720 GCCTGAGCTCGGGGAGGCGGAGG + Intronic
1024082740 7:45868565-45868587 GCCTCACATTGGGGATGAGGTGG - Intergenic
1027188233 7:75984207-75984229 TCCTGACTTCAGTGAGGAGGTGG - Intronic
1029238350 7:99142543-99142565 GCCAGACAGCAGCGAGGGGGCGG + Intronic
1029238649 7:99143544-99143566 GCCGGGCAACGGCGAGGGGGCGG + Intronic
1034206594 7:149321414-149321436 GCCTGGTTTCGGGGAGGAGGAGG - Intergenic
1034253737 7:149713608-149713630 GCCTCACCTCGGCACGGAGGTGG + Intergenic
1036037933 8:5040660-5040682 GTCTGACCTGTGCGAGGAGGAGG - Intergenic
1036950269 8:13133365-13133387 CCCAGACAGCGGGGAGGAGGCGG - Intronic
1045449779 8:102310774-102310796 GCCTGAAAGCGAGGAGGAGGAGG - Intronic
1048615454 8:136069651-136069673 GCGTGAGATAGGTGAGGAGGAGG - Intergenic
1056278765 9:85019267-85019289 GCCTGACAGCTGAGAGCAGGTGG - Intronic
1060730291 9:126032922-126032944 GCCTGAACCCGGCGGGGAGGAGG - Intergenic
1061802818 9:133121364-133121386 GTCTGACCTCGGCGAGGGCGGGG - Intronic
1061936502 9:133860616-133860638 GCCTGAGAGCAGCGAGGATGGGG - Intronic
1185736576 X:2500712-2500734 GCGTGACCTTGGCGAGGCGGTGG - Intronic
1189279546 X:39811606-39811628 GGCTGACATCAGTGGGGAGGAGG + Intergenic
1190328266 X:49219773-49219795 GCCAGACATGGAGGAGGAGGAGG - Exonic
1190862717 X:54359002-54359024 GCCTGGCGGCGGCGAGGGGGCGG - Intergenic
1200358576 X:155578203-155578225 GCCTGCCATCTGGGAGGATGGGG - Intronic