ID: 985070167

View in Genome Browser
Species Human (GRCh38)
Location 4:186159765-186159787
Sequence TGTTCACGCGAGGCCTGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 40}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985070167 Original CRISPR TGTTCACGCGAGGCCTGTAG TGG Intronic
901413550 1:9101729-9101751 TGGTCAGGAAAGGCCTGTAGAGG - Exonic
902916155 1:19640875-19640897 TGTGCCAGCCAGGCCTGTAGGGG + Intronic
904813080 1:33176479-33176501 TGGTCACATGAGGCCTGGAGGGG + Intronic
907293338 1:53432825-53432847 TGTTCACACAAAGCCTGTTGTGG - Intergenic
912994161 1:114516698-114516720 TGTTCACTGGAGGCCAGGAGCGG - Intergenic
915004458 1:152623416-152623438 TGTTCACGGGACGCCTGCAGGGG - Intergenic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
1083087225 11:60161963-60161985 TGTGAACGCCAGGCCTGTGGGGG - Intergenic
1093525672 12:20101810-20101832 AGTTCACGGGAGACCTGAAGTGG + Intergenic
1095951352 12:47783594-47783616 TGTTCTCGAGAGCCCTGTGGGGG + Exonic
1100524137 12:95404277-95404299 TGTTCACCCAAGGCCTGTGAGGG - Intergenic
1100685455 12:96982541-96982563 TGTTCAAGCCAGGACTGTGGAGG - Intergenic
1103520902 12:121536704-121536726 TGTTCAGCTGAGGCCTGGAGGGG - Intronic
1107988474 13:45796592-45796614 TGTTCACACCATGCCTGGAGTGG + Intronic
1110939496 13:81331106-81331128 TGTTCAGAGGAGACCTGTAGTGG - Intergenic
1110979035 13:81872384-81872406 TGTTCACACGAAGCCTGTTTGGG + Intergenic
1119720204 14:76885058-76885080 TGTTCCCGGGAGGCCGGGAGAGG + Intergenic
1129302776 15:74635589-74635611 TGTTCACCAGAGGCCTACAGTGG - Exonic
1129939075 15:79478233-79478255 TGTTCAGGAGAGGCCGGGAGTGG - Intergenic
1136577288 16:31132227-31132249 TGTACACACCAGGCCTGTTGCGG + Exonic
1143033669 17:3982312-3982334 GGCTCACGAGAGGCCTGTGGTGG + Intergenic
1148695303 17:49555138-49555160 TGTTGGCCCGAGGTCTGTAGTGG - Intergenic
1160008321 18:75084916-75084938 TGATCACACGATGCCTGTACAGG + Intergenic
1160236129 18:77087947-77087969 TGTCCACGCGGCGCCTGGAGGGG + Intronic
1161489830 19:4555802-4555824 TGTCCAAACGAGGCCTGTACAGG - Intronic
1164362417 19:27528929-27528951 TTTTCACCCTAGGCCTGTATGGG - Intergenic
1168268852 19:55238944-55238966 TGTTACCCCGAGGCCTGTGGAGG + Intronic
927124681 2:20003145-20003167 TGTTCAGGTGAGGCCTGTGTAGG - Exonic
937899294 2:127005378-127005400 TCTTCCCGAGAGGCCTGGAGAGG + Intergenic
947403157 2:229748942-229748964 TGTTCACGGCAGGCCTGTGTTGG - Intergenic
948994024 2:241569773-241569795 TGTGGACGCCAGGCCTGTTGTGG + Intronic
1170445144 20:16418716-16418738 TGTTCACGCAACTCATGTAGAGG + Intronic
1181497542 22:23295959-23295981 TCTTCACAAGAGGCCTCTAGAGG + Intronic
950006518 3:9695025-9695047 TGTTCTCTCCAGTCCTGTAGTGG + Intronic
961986274 3:131138274-131138296 TGTTCCCTGTAGGCCTGTAGTGG + Intronic
964055876 3:152456464-152456486 TGTGTACGTGAGGGCTGTAGAGG + Intronic
985070167 4:186159765-186159787 TGTTCACGCGAGGCCTGTAGTGG + Intronic
1017554310 6:155546669-155546691 TGTTCCCAGGAGGACTGTAGGGG + Intergenic
1018068678 6:160142098-160142120 TGGGCACGGGAGGCCTGAAGAGG + Intronic
1195476075 X:105287296-105287318 TGTGCAAGCGTGCCCTGTAGAGG + Intronic
1201766706 Y:17579583-17579605 TGTTCACGCGTGCCCAGTGGTGG - Intergenic
1201834846 Y:18326401-18326423 TGTTCACGCGTGCCCAGTGGTGG + Intergenic