ID: 985073606

View in Genome Browser
Species Human (GRCh38)
Location 4:186191648-186191670
Sequence CTCTCTGGCCGCCGCCCGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985073596_985073606 5 Left 985073596 4:186191620-186191642 CCGGGCGCAGGAACAGCCCCGTG 0: 1
1: 0
2: 0
3: 12
4: 146
Right 985073606 4:186191648-186191670 CTCTCTGGCCGCCGCCCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 116
985073595_985073606 10 Left 985073595 4:186191615-186191637 CCGGGCCGGGCGCAGGAACAGCC 0: 1
1: 0
2: 2
3: 16
4: 188
Right 985073606 4:186191648-186191670 CTCTCTGGCCGCCGCCCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 116
985073591_985073606 27 Left 985073591 4:186191598-186191620 CCGCGGTGCTGCGTAGGCCGGGC 0: 1
1: 0
2: 0
3: 8
4: 64
Right 985073606 4:186191648-186191670 CTCTCTGGCCGCCGCCCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985073606 Original CRISPR CTCTCTGGCCGCCGCCCGGG CGG Exonic