ID: 985073606

View in Genome Browser
Species Human (GRCh38)
Location 4:186191648-186191670
Sequence CTCTCTGGCCGCCGCCCGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985073591_985073606 27 Left 985073591 4:186191598-186191620 CCGCGGTGCTGCGTAGGCCGGGC 0: 1
1: 0
2: 0
3: 8
4: 64
Right 985073606 4:186191648-186191670 CTCTCTGGCCGCCGCCCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 116
985073595_985073606 10 Left 985073595 4:186191615-186191637 CCGGGCCGGGCGCAGGAACAGCC 0: 1
1: 0
2: 2
3: 16
4: 188
Right 985073606 4:186191648-186191670 CTCTCTGGCCGCCGCCCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 116
985073596_985073606 5 Left 985073596 4:186191620-186191642 CCGGGCGCAGGAACAGCCCCGTG 0: 1
1: 0
2: 0
3: 12
4: 146
Right 985073606 4:186191648-186191670 CTCTCTGGCCGCCGCCCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985073606 Original CRISPR CTCTCTGGCCGCCGCCCGGG CGG Exonic
900087517 1:905431-905453 CTCTCTGGGGAGCGCCCGGGAGG - Intergenic
900116914 1:1032952-1032974 CTCCCTGGCCGCTGCCCAGCCGG - Intronic
902270565 1:15301471-15301493 CTCTCAGGCCAAGGCCCGGGAGG + Intronic
905308054 1:37032780-37032802 CTCCCGGGCGGCCGCCCAGGAGG + Intronic
913191767 1:116418830-116418852 TTCACTGGCCGACGCGCGGGTGG - Intergenic
1065483860 10:26217894-26217916 CCCGCGGGCCGCCGCCCGGAAGG + Exonic
1073063156 10:100744156-100744178 CCCTCTGGCCGGAGCCTGGGCGG - Intronic
1073491416 10:103855541-103855563 CGCTCTCTCCGCCGCCCGGTGGG + Intronic
1077053154 11:576704-576726 CGCGCTGGCCGCGGGCCGGGAGG + Intronic
1077361180 11:2140742-2140764 GTCTCCGGCTGCCGCCGGGGAGG - Intronic
1078222625 11:9364341-9364363 CGCTCCGGCCTCCGCCCGCGAGG - Intergenic
1083954540 11:65976297-65976319 CTGTCTGGCTGCTGCCAGGGAGG + Intronic
1084180573 11:67443608-67443630 CTCTCTGGCCCCGTCCCCGGCGG - Intronic
1084523919 11:69684286-69684308 CTCTCTTGGAGCCTCCCGGGGGG - Intergenic
1087672752 11:101127549-101127571 CTCTGCCGCCGCCGCCGGGGCGG - Exonic
1089814737 11:121162294-121162316 CTCCCTGGCCGCCTACGGGGAGG + Exonic
1102013030 12:109630761-109630783 CTTTCTGGCAGCCTCCTGGGTGG + Intergenic
1102177507 12:110886821-110886843 CTCTCTGTCCCCCTCCCGGAAGG + Intronic
1106226403 13:27790032-27790054 CTCTCCGGCCGCGGCCCGCCGGG + Intergenic
1107412663 13:40172310-40172332 TTCTCCCGCAGCCGCCCGGGAGG + Intergenic
1110436561 13:75482482-75482504 CTCTCCGCCCGCCGGACGGGAGG - Intergenic
1112315855 13:98361520-98361542 CTCTCTTGCCACTGCCAGGGTGG - Intronic
1113437906 13:110307411-110307433 CTCTCTGGGCGCCGGCCCCGGGG - Exonic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1114228924 14:20762908-20762930 ATCTATGGCCGCCTCCTGGGGGG - Intergenic
1114516212 14:23301826-23301848 CTCGCTGGCCGGCTCCAGGGCGG + Exonic
1123036486 14:105473992-105474014 CTCCCCGGCCGCCCCCTGGGTGG + Intronic
1124211549 15:27768942-27768964 CCCTCTGGCTGCCTCCCGGCTGG - Intronic
1126467707 15:48975969-48975991 CGCTCTCCCCGCCGCCCGGCCGG - Intergenic
1127867184 15:63042495-63042517 CTCTCCGGCCGCCGCCTCGGCGG + Intergenic
1129298935 15:74614745-74614767 CTGGCTGGCGGCCGCCGGGGCGG + Intronic
1129738792 15:77979932-77979954 CTCTGTGGCCCCAGCCCCGGGGG - Intergenic
1130254733 15:82320640-82320662 CTCTGTGGCCCCAGCCCCGGGGG - Intergenic
1130600240 15:85269366-85269388 CTCTGTGGCCCCAGCCCCGGGGG + Intergenic
1130656276 15:85794142-85794164 CAGTCTGGCCGCCACCCAGGTGG + Intronic
1133030019 16:3006106-3006128 CTCTCAGGGCCCAGCCCGGGTGG - Intergenic
1136284381 16:29232569-29232591 CACTCTGGCCACTGCCCGTGGGG - Intergenic
1141838108 16:86555870-86555892 CTCTCTGGCCCCAGCCCCGCGGG + Intergenic
1142089415 16:88202081-88202103 CACTCTGGCCACTGCCCGTGGGG - Intergenic
1146269674 17:31476757-31476779 CTCTGTGGCTGCAGCCCAGGAGG - Intronic
1146445230 17:32927946-32927968 CTCTCCGTCTGCCGCCCGGACGG + Exonic
1150160750 17:62895871-62895893 CTCTCTGGCCGCTGCTAGTGTGG + Intergenic
1150239943 17:63622918-63622940 CTCGCGCGCCGCGGCCCGGGCGG + Intronic
1150652487 17:67018996-67019018 CTCCCTGGCTGCTGCCAGGGAGG - Intronic
1150652488 17:67018997-67019019 CTCCCTGGCAGCAGCCAGGGAGG + Intronic
1151347493 17:73511049-73511071 CCCACTGCCCGCCGCCCGGCTGG + Intronic
1151662539 17:75526219-75526241 CGCTCCGGCCGCCGCCCGTGGGG - Intronic
1155582407 18:27324539-27324561 CTCTCTGGCCTCACCCCAGGGGG - Intergenic
1157613963 18:48976055-48976077 CTCCCGGGGCGCCGCGCGGGTGG + Intergenic
1160738746 19:676446-676468 CACTCTGGCCTCTGCCCTGGGGG + Exonic
1161779264 19:6280091-6280113 CCCTCCGGCCGCAGCCCGGCAGG - Intergenic
1161864905 19:6826669-6826691 CCGTGTGGCCGCAGCCCGGGAGG + Exonic
1162873066 19:13600329-13600351 CTCTGTGGCCGGCACCTGGGAGG - Intronic
1163268285 19:16234319-16234341 CTCTGTGGCTGCCCCCAGGGTGG + Intronic
1163633653 19:18428963-18428985 CTCTCTGGGCGCCCCCCGCCGGG + Intronic
1163715528 19:18870311-18870333 CTCTCTGGTCATCGCCTGGGAGG - Exonic
1165357222 19:35311724-35311746 CTCTGTGGCCCCTGCCCGGCTGG - Intronic
1167633433 19:50639632-50639654 CTCTCTGGCCACCCCGGGGGAGG - Intronic
926185924 2:10690521-10690543 CTGCCTCGCCCCCGCCCGGGAGG - Intergenic
933684953 2:85134586-85134608 CTCTCTGGCGGCCGAGCGCGAGG + Intronic
935046699 2:99489719-99489741 CGCTCTGGCCGCTGCCGGGCGGG + Intronic
935196650 2:100820285-100820307 GCCTCCCGCCGCCGCCCGGGAGG + Exonic
935622728 2:105143841-105143863 CTCTCACCCCGCCCCCCGGGGGG + Intergenic
936104692 2:109614317-109614339 CTCACTGGGCCGCGCCCGGGCGG - Exonic
937759343 2:125581667-125581689 CTCTCTAGGTGCCTCCCGGGAGG + Intergenic
942150930 2:173075718-173075740 CTCCCTGGCCTGCGCCCGGGGGG - Intronic
946412634 2:219522733-219522755 CTCCCCGGCCGCCGCGGGGGCGG + Intronic
1169193935 20:3673546-3673568 CTCCCTCGCCCCCGCCCGCGGGG + Intronic
1172914745 20:38435116-38435138 CTCTCTGGCCGCCTTCCCCGGGG + Intergenic
1174049901 20:47760282-47760304 CTCTCTGGCTTCCGGCTGGGAGG + Intronic
1175871116 20:62210005-62210027 CTTTCTGGCGCCCGCCTGGGAGG - Intergenic
1179928301 21:44550515-44550537 CTCTCTGACCTCCCGCCGGGCGG - Exonic
1179941261 21:44639848-44639870 CTGTCTGGCCGTCCCCAGGGAGG + Intronic
1180046348 21:45307534-45307556 CTCTCTGCCCGCCGCCCTCCTGG - Intergenic
1182593394 22:31399442-31399464 CTCTCTGGCCTCCGCTCCCGCGG + Intergenic
1184504903 22:44894747-44894769 CTCTCTGGCAGCAGCCAGGATGG - Intronic
1185128286 22:49023714-49023736 CTCCCTGGCTGTCGCCCAGGTGG - Intergenic
950072602 3:10164777-10164799 TTCTCTGGCCGGCGCTGGGGTGG + Intergenic
951555422 3:23916689-23916711 CTCTCTGGCCACCGCACGACGGG - Exonic
960702474 3:120451298-120451320 CTGGCTGGCGGCGGCCCGGGCGG + Intergenic
961322270 3:126084100-126084122 CTTTCCCGCCGCCGCCTGGGAGG - Exonic
966684829 3:182682732-182682754 CTCCCGGGCCGGCGCGCGGGGGG - Intergenic
968759275 4:2433661-2433683 CTCTCTGGCGAGCGCCCAGGTGG + Intronic
969716817 4:8871847-8871869 CGTTCTGGTCGCCGCCGGGGCGG + Intergenic
971231024 4:24800253-24800275 GTCCCTGGCCGCCGCCGGGTGGG - Exonic
973532167 4:51844377-51844399 CTCGCTTCCCGCCGTCCGGGGGG - Intronic
976619536 4:87114463-87114485 CTCTCTGGGTGCCGCCGTGGGGG - Exonic
983077647 4:163344415-163344437 CGCTCTGGCTGCAGCCCGGCTGG + Exonic
985073606 4:186191648-186191670 CTCTCTGGCCGCCGCCCGGGCGG + Exonic
985689807 5:1300930-1300952 CCCTCTGGCACACGCCCGGGTGG + Intergenic
987050376 5:14143459-14143481 CGCTCCGGCCGGCGCCCGGGAGG + Intergenic
999736730 5:154518565-154518587 CTCTGTGGCCCCAGCACGGGTGG - Intergenic
1002529178 5:179833712-179833734 CTCTCTGGACCCCTCCCAGGAGG + Exonic
1002638984 5:180621686-180621708 CCCTCTGGCCGCCAGCCTGGAGG - Exonic
1015625930 6:135181176-135181198 CGCCCTGGCTGCCGCCCGCGGGG - Intergenic
1018953513 6:168393477-168393499 CTCTCTGCCCGCTGCCCTGCTGG + Intergenic
1019601489 7:1885911-1885933 ATCTCTGGCCCCAGCCCTGGGGG + Intronic
1020246890 7:6436423-6436445 CTCTCTGGGGGCTGCCTGGGTGG - Exonic
1023382678 7:39623867-39623889 CACCCCCGCCGCCGCCCGGGTGG - Intronic
1032021767 7:128410381-128410403 CTCTCTCGCCCCAGCGCGGGAGG - Intergenic
1032468508 7:132161725-132161747 CGCTCTGGCAGGCTCCCGGGCGG + Intronic
1037768184 8:21784464-21784486 CTCTCAGGCCATCCCCCGGGAGG + Intronic
1037886844 8:22599894-22599916 CTCCCTCGCCGCCTCCCTGGAGG + Intronic
1038644379 8:29350495-29350517 CGCTCTGCGCGCCGCCCGGCTGG - Exonic
1039469258 8:37803378-37803400 CTCTCTGGCTGCTCCCAGGGAGG - Intronic
1039493675 8:37965680-37965702 CTCTCTGGCCCCGGCCCCGGTGG - Exonic
1039910112 8:41819771-41819793 CTCTCTGGCCTCTGCCAGGCTGG - Intronic
1047402541 8:124558686-124558708 CGCTGTGGCTGCCACCCGGGCGG + Intronic
1048244174 8:132775531-132775553 CTCCCCGGCCGCTGCCTGGGCGG + Exonic
1048971209 8:139645822-139645844 CTCTCTGGCCTCCACCCAGAGGG + Intronic
1050151286 9:2621793-2621815 CTCTCCGGCCGCCGCCGGTGCGG + Intergenic
1052982043 9:34457294-34457316 CTTGCTGGCCACCGCCCAGGGGG - Intronic
1056922337 9:90801817-90801839 CTCTCCAGCCGCCGCCGGGGTGG - Exonic
1057488622 9:95506065-95506087 CTCTCGGGGCGCGGCCCAGGCGG + Intronic
1057554535 9:96077085-96077107 CTCTCTCGTCGCCGCACAGGGGG + Intergenic
1058687026 9:107488650-107488672 CTCTCGGGCCACCGGGCGGGAGG - Intronic
1060728874 9:126024738-126024760 TTCTGTGGCCCCCGCCCAGGAGG - Intergenic
1061299686 9:129697508-129697530 CGCTCTGGCCGCCACCAGCGCGG + Intronic
1061653433 9:132069261-132069283 CTCACTGGCCGGCCCCAGGGAGG - Intronic
1062162098 9:135086451-135086473 CTCTCAGGCGGGCGCCAGGGAGG + Intronic
1062213067 9:135374984-135375006 CTCTGTGGCCGCCTCCGGGGTGG + Intergenic
1062507936 9:136887362-136887384 CCATCTGGCCGCCTCCCGAGAGG - Intronic
1186426141 X:9465342-9465364 CTCTTCGGCCGCCGCACGGCCGG + Exonic
1197709482 X:129655208-129655230 CCCTCTGGCCCCCGGCCAGGCGG - Intergenic
1200244624 X:154516334-154516356 CGCGCTGGCCGCCGCATGGGAGG + Intergenic