ID: 985075206

View in Genome Browser
Species Human (GRCh38)
Location 4:186207319-186207341
Sequence GAATGACATGAACCCCTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 250}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985075202_985075206 4 Left 985075202 4:186207292-186207314 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 985075206 4:186207319-186207341 GAATGACATGAACCCCTCAGGGG 0: 1
1: 0
2: 0
3: 13
4: 250
985075200_985075206 5 Left 985075200 4:186207291-186207313 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 985075206 4:186207319-186207341 GAATGACATGAACCCCTCAGGGG 0: 1
1: 0
2: 0
3: 13
4: 250
985075198_985075206 13 Left 985075198 4:186207283-186207305 CCTGTAGTCCCAGCTACTCGGGA 0: 54379
1: 173656
2: 264604
3: 194654
4: 115454
Right 985075206 4:186207319-186207341 GAATGACATGAACCCCTCAGGGG 0: 1
1: 0
2: 0
3: 13
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985075206 Original CRISPR GAATGACATGAACCCCTCAG GGG Intronic
900587899 1:3442249-3442271 GCATGACCTGAACCCCAAAGAGG + Intergenic
900701137 1:4049341-4049363 GAATTACATCAGCTCCTCAGAGG + Intergenic
901432473 1:9225449-9225471 GAAGGACAAGGAACCCTCAGAGG - Intergenic
901935396 1:12622851-12622873 GAATGACATGACCGGCCCAGAGG - Intergenic
903146957 1:21380113-21380135 GAATGGCATGAACCCATGAGTGG - Intergenic
903208102 1:21798168-21798190 GAATGGCATGAACCCAGAAGTGG - Intergenic
903271997 1:22195166-22195188 GAATCACTTGAACCCGGCAGGGG + Intergenic
903711396 1:25327551-25327573 GAATTACTTGAACCCCTGGGGGG + Intronic
903715552 1:25363878-25363900 GAATTACTTGAACCCCTGGGGGG - Intronic
904052239 1:27646666-27646688 GGGTGACATCAACCCCCCAGGGG + Intergenic
904062633 1:27723774-27723796 GAATCACCTGAACCCCTGGGAGG + Intergenic
906357551 1:45120254-45120276 GAATCACTTGAACCCCGGAGGGG + Intronic
906437710 1:45811252-45811274 GAATTGCTTGAACCCCACAGGGG - Intronic
908215736 1:61949816-61949838 GAATCACATGAACCTGGCAGAGG + Intronic
909244320 1:73257785-73257807 GAATCACTTGAACCCGGCAGGGG + Intergenic
909786838 1:79623871-79623893 GAATGGCATGAACCCCAGAGGGG - Intergenic
910526561 1:88185673-88185695 GAATGGCATGAACCCAGGAGGGG - Intergenic
911197974 1:95015137-95015159 GAATGCCATTCACCTCTCAGTGG + Intronic
911258606 1:95661347-95661369 GGATGACATGAGCCCCTTGGTGG + Intergenic
912242478 1:107926192-107926214 GAATGACTTGAACCCGGGAGTGG + Intronic
912342504 1:108930799-108930821 GAATCACTTGAACCCCTGGGAGG + Exonic
912581520 1:110724997-110725019 GAATGGCATGAACCCGGGAGGGG + Intergenic
914357175 1:146896858-146896880 GAATGACATGAAACCAGGAGGGG + Intergenic
914793366 1:150899008-150899030 GAATGGCATGAACCCGGGAGGGG + Intergenic
915436131 1:155908000-155908022 GAATGGCATGAACCCCGGGGGGG + Intronic
916100208 1:161388100-161388122 GAATGGCATGAACCCGGGAGGGG - Intergenic
917347734 1:174045988-174046010 GAATCACTTGAACTCCTGAGGGG - Intergenic
917499942 1:175577021-175577043 GAATGAATTGAAACCCCCAGGGG - Intronic
917772287 1:178292735-178292757 GACAAACATGAACCCCTCAGAGG + Intronic
918180236 1:182081023-182081045 GAATGAGAGGAAGCCCTCTGGGG + Intergenic
919451088 1:197774807-197774829 GAAGCACGAGAACCCCTCAGCGG + Intronic
919540896 1:198843744-198843766 GAATGACTTGAACCCGGGAGGGG + Intergenic
920525548 1:206663515-206663537 GAATGAGATGAAACCTTAAGTGG + Intronic
921559122 1:216635649-216635671 GAATTACAGAGACCCCTCAGTGG - Intronic
922644625 1:227274192-227274214 GAAGGAAAGGAACCCCCCAGTGG + Intronic
922822332 1:228493189-228493211 CAGTGACCTGAACCGCTCAGTGG - Exonic
923722846 1:236482023-236482045 GAATGGCGTGAACCCCTGGGAGG + Intronic
1063124588 10:3127399-3127421 GAATGACATCAACCGCTTAATGG - Intronic
1065472443 10:26095956-26095978 GAAACACATGACCACCTCAGGGG + Intronic
1066261796 10:33736524-33736546 GAATTACTTGAACCCCTCGGTGG - Intergenic
1067347576 10:45447586-45447608 GTTTGGCATGAACCCCACAGTGG + Intergenic
1067729483 10:48799683-48799705 GAATCACTTGAACCCATAAGGGG + Intronic
1067856414 10:49797302-49797324 GAATGGCATGAACCCAGGAGGGG - Intergenic
1068371929 10:56128301-56128323 GAATGGCATGAACCCGGGAGGGG + Intergenic
1069437245 10:68396084-68396106 GAATCACATGAACCCGGTAGAGG - Intronic
1070498596 10:77048846-77048868 GAATGGCATGAACCCGCGAGGGG - Intronic
1071786396 10:88905046-88905068 GACTGACATGAACCCTACAATGG + Intronic
1072110528 10:92315514-92315536 AAATGATATGAACACTTCAGTGG + Intronic
1073352211 10:102828056-102828078 GAATGGCATGAACCCGGGAGGGG - Intergenic
1074417459 10:113279834-113279856 GAATGGCGTGAACCCCGGAGGGG - Intergenic
1076074525 10:127522713-127522735 GAATTCCATGCACCCCACAGTGG - Intergenic
1077002005 11:328153-328175 GAAAGAAGTGAACCCCTGAGAGG - Intergenic
1077184256 11:1229305-1229327 GTGTGCCCTGAACCCCTCAGGGG + Intronic
1081163709 11:39784322-39784344 GAATGGCATGAACCCGGGAGGGG - Intergenic
1081410103 11:42747482-42747504 GAATGGCATGAACCCAGGAGAGG + Intergenic
1081950886 11:47041519-47041541 GAAGGGCATGAACTTCTCAGTGG - Intronic
1085736001 11:79039582-79039604 GATGGGCAGGAACCCCTCAGAGG + Intronic
1085870033 11:80338676-80338698 GAATGACATGGAAACCACAGTGG + Intergenic
1089299929 11:117492536-117492558 GGATTACATGCACCCCTGAGAGG + Intronic
1089310003 11:117551741-117551763 AAATTACACGAAGCCCTCAGAGG - Intronic
1089393949 11:118122701-118122723 GAATGACAGGAAGCCATCATTGG + Intergenic
1089607475 11:119649881-119649903 GACACACATGAAACCCTCAGTGG - Intronic
1090763824 11:129859730-129859752 GAATGGCATGAACCCGGTAGGGG + Exonic
1091240968 11:134052112-134052134 GAATGGCATGAACCCGGGAGCGG + Intergenic
1094189583 12:27683873-27683895 GAATGGCATGAACCCAGGAGAGG - Intronic
1095450861 12:42329187-42329209 GAATGGCATGAACCCGGGAGGGG - Intronic
1096314503 12:50552352-50552374 GAATGGCATGAACCCGGGAGGGG - Intronic
1097204324 12:57307406-57307428 GAATCACTTGAACCCCTGGGAGG - Intronic
1101545415 12:105707547-105707569 GAAGAACATGAACCCCGGAGTGG - Intergenic
1102471866 12:113163838-113163860 GCACGACATGACACCCTCAGTGG - Intronic
1103516722 12:121513132-121513154 GAATCCTAGGAACCCCTCAGGGG - Intronic
1104487478 12:129163792-129163814 GACTGACAGGAACCTCACAGAGG - Intronic
1104918160 12:132277135-132277157 GCATGGCTTTAACCCCTCAGAGG - Intronic
1106095315 13:26638110-26638132 TAAAGACAAGAACCCCTCATCGG - Intronic
1108157486 13:47600932-47600954 GAATGGCGTGAACCCGGCAGGGG + Intergenic
1109932356 13:69232861-69232883 GAATCACTTGAACCCGGCAGTGG - Intergenic
1111197718 13:84895673-84895695 GAATGGCATGAACCCGTGAGCGG + Intergenic
1111238211 13:85437017-85437039 TATTTACATTAACCCCTCAGAGG - Intergenic
1111446752 13:88355870-88355892 GAATGACATTTCCCACTCAGGGG + Intergenic
1111831838 13:93340120-93340142 GAATGGCATGAACCTGGCAGCGG - Intronic
1113979996 13:114266781-114266803 GAATGGCATGAACCCCGGTGAGG - Intronic
1114286995 14:21253978-21254000 GAATGGCATGAACCCGGGAGAGG + Intronic
1114722507 14:24897320-24897342 GAATGGCATGAACCCGGGAGGGG + Intronic
1115570800 14:34664579-34664601 GAATCACTTGAACCCGTGAGTGG - Intergenic
1116753857 14:48921304-48921326 GAATGGCATGAACCCAGGAGGGG + Intergenic
1118824358 14:69367035-69367057 GAATGAGATGTACCCCTAAAAGG + Intergenic
1118909536 14:70049795-70049817 GAATGACAGCCATCCCTCAGGGG - Intronic
1119784625 14:77303177-77303199 GAATGACATGATCCTCTCTTGGG - Intronic
1121809539 14:96870427-96870449 GCATGTCATGGAACCCTCAGAGG + Intronic
1123578600 15:21696199-21696221 ACATGACATGAAACCATCAGAGG - Intergenic
1123615227 15:22138681-22138703 ACATGACATGAAACCATCAGAGG - Intergenic
1124165312 15:27320920-27320942 GACTGACATGGCCTCCTCAGGGG + Intronic
1126247617 15:46527546-46527568 GAATGGCATGAACCCGGGAGGGG + Intergenic
1126917137 15:53478200-53478222 ACATGACACGAACCCCTGAGTGG + Intergenic
1127106815 15:55625709-55625731 GAATGGCATGAACCCGGGAGGGG - Intronic
1127304466 15:57691145-57691167 CAGTGACATAAACTCCTCAGGGG + Intronic
1128613419 15:69091337-69091359 GAAAGATGTGAACCCCTCAGTGG - Intergenic
1130534149 15:84771140-84771162 GAAAGACATGACCCCCACACAGG + Intronic
1130927047 15:88393407-88393429 GAATGACATGGGCTCCTCAAAGG - Intergenic
1131409984 15:92199596-92199618 GACTGACCAGAACCTCTCAGTGG + Intergenic
1131453771 15:92567215-92567237 GACTGACTAGAACCTCTCAGTGG - Intergenic
1202987470 15_KI270727v1_random:430444-430466 ACATGACATGAAACCATCAGAGG - Intergenic
1133029315 16:3002494-3002516 GAATGGCATGAACCCGGGAGGGG - Intergenic
1134309009 16:13059213-13059235 GAATGGCATGAACCCGGGAGGGG - Intronic
1136385135 16:29920234-29920256 GAATCACTTGAACCCCAGAGAGG + Intronic
1136611176 16:31366601-31366623 GAATCACTTGAACCCCAGAGGGG - Intronic
1137414240 16:48258257-48258279 GAATGACGTGAACCCAGGAGGGG + Intronic
1138403881 16:56772555-56772577 GAATGACATTTCCCCATCAGGGG + Intronic
1139009956 16:62619381-62619403 GAATGGCATGAACCCAGGAGGGG + Intergenic
1139620155 16:68133176-68133198 GAATCACATGAACCCGTGGGTGG + Intronic
1139976995 16:70820276-70820298 GAATGACATGAAACCAGGAGGGG - Intronic
1141084662 16:81084797-81084819 GAATGGCATGAACCCTTGGGAGG - Intronic
1141726114 16:85789702-85789724 GAATCACTTGAACCCCAGAGGGG + Intronic
1142208975 16:88798688-88798710 GAATCGCTTGAACCCCGCAGAGG + Intergenic
1143407303 17:6685982-6686004 AAATGAAGGGAACCCCTCAGTGG - Exonic
1143684144 17:8500435-8500457 GAATGTCAGGAACCCCTGAAGGG + Intronic
1145740002 17:27265858-27265880 GAATCACTTGAACCCCACAGGGG - Intergenic
1146129726 17:30260971-30260993 GAGAGACATGAAACCCTCTGAGG + Intronic
1147176383 17:38658642-38658664 GAGTGACATGGAACCCACAGTGG + Intergenic
1148120308 17:45205904-45205926 GAATGGCATGAACCCAGCCGGGG - Intergenic
1148706539 17:49638499-49638521 AAATCACTTGAACCCCACAGTGG + Intronic
1151401600 17:73859228-73859250 CAATGACATGAGCCATTCAGAGG - Intergenic
1151402138 17:73862745-73862767 CAATGACATGAGCCATTCAGAGG + Intergenic
1153673996 18:7439450-7439472 GAATGGCATGAACCCAGGAGGGG + Intergenic
1155581922 18:27318631-27318653 GAATGGCATGAACCCAGGAGAGG - Intergenic
1156242162 18:35265056-35265078 GAATGGCATGAACCCGGGAGGGG + Intronic
1157215566 18:45780391-45780413 GAATGGCATGAACCCGGGAGGGG + Intergenic
1157556944 18:48619078-48619100 GGAGGACCTGAGCCCCTCAGAGG + Intronic
1159606637 18:70481207-70481229 GAATTACTTGAACCCAGCAGTGG - Intergenic
1159721329 18:71895282-71895304 GAATGACATGAGCATCTCAATGG - Intergenic
1162096786 19:8314823-8314845 GAATGGCGTGAACCCCTGGGAGG + Intronic
1162716762 19:12639283-12639305 GAATGGCATGAACCCCGGAAGGG - Intronic
1163429047 19:17255911-17255933 GAATCACTTGAACCCGGCAGTGG + Intronic
1164170574 19:22721477-22721499 GAATCACTTGAACCCAGCAGGGG - Intergenic
1165147866 19:33743387-33743409 GAATGGCATGAACCCCCGGGGGG - Intronic
1165579990 19:36854042-36854064 TAATAACATGAGCCTCTCAGTGG + Intronic
1167538517 19:50070808-50070830 GGGTGACATGACCCGCTCAGGGG + Intergenic
1168621557 19:57883268-57883290 GAATGGCATGAACCCCAGGGGGG + Intronic
926438449 2:12861461-12861483 GAGTGACATGAATCACTGAGAGG + Intergenic
927406325 2:22773657-22773679 GAATGTCTTGAACCCGGCAGAGG - Intergenic
927869515 2:26614681-26614703 GACTCACATGCACCCCTCACAGG + Intronic
928776617 2:34771931-34771953 GAATGGCATGAACCCCCCGGGGG + Intergenic
929884484 2:45866393-45866415 GAATGGCATGAACCCAGGAGCGG - Intronic
932365244 2:71147583-71147605 GAATGGCATGAACCCTTAAGAGG + Intronic
936668134 2:114622135-114622157 AAATGAGATGAACCCATCATTGG + Intronic
936679502 2:114753819-114753841 GAATGGCATGAACCCGGGAGGGG + Intronic
936708459 2:115103273-115103295 GAATGGCATGAACCCGGGAGGGG - Intronic
937507851 2:122557007-122557029 GAATGGCATGAACCCCGGTGGGG + Intergenic
937970240 2:127543830-127543852 GAATGGCGTGAACCCGGCAGGGG - Intronic
938283593 2:130087718-130087740 GAATGGCATGAACCCAGGAGAGG - Intronic
938334228 2:130476282-130476304 GAATGGCATGAACCCAGGAGAGG - Intronic
938432014 2:131251175-131251197 GAATGGCATGAACCCAGGAGAGG + Intronic
938762441 2:134437925-134437947 GAATCACATGAACCTGGCAGAGG + Intronic
939845831 2:147245148-147245170 GAATGACGTGAACCCGGGAGGGG - Intergenic
940050266 2:149455049-149455071 GAATGTCAGGCACCACTCAGGGG + Intronic
943020604 2:182568576-182568598 GAATGGCATGAACCCGGGAGGGG + Intergenic
943988011 2:194647392-194647414 GAATCACTTGAACCCGGCAGGGG + Intergenic
944427670 2:199600241-199600263 GAATGGCATGAACCCGGGAGGGG - Intergenic
944690952 2:202158080-202158102 GAATGGCATGAACCCAGGAGGGG - Intronic
947177801 2:227384898-227384920 GAATTAGATCAACCCCTGAGGGG - Intergenic
947426128 2:229984474-229984496 GAATGACGTGAACCCGGGAGCGG - Intronic
947455123 2:230247102-230247124 GAGAGACATGAAAGCCTCAGGGG - Intronic
947660060 2:231859892-231859914 GAATCACTTGAACCCGGCAGAGG - Intergenic
948103411 2:235393293-235393315 AAATGACAGGAGTCCCTCAGGGG + Intergenic
1168956686 20:1838991-1839013 GAATGACATGGACCACCGAGTGG + Intergenic
1170023831 20:11866473-11866495 GAATGCCATGAACCCGGGAGGGG + Intergenic
1170039208 20:12022720-12022742 GAATGGCATGAACCCGGTAGTGG - Intergenic
1170514165 20:17110541-17110563 GAATGGCATGAACCCAGGAGGGG + Intergenic
1170943079 20:20865278-20865300 GAATGGCATGAACCCGGGAGGGG - Intergenic
1174312304 20:49667337-49667359 GAATGGCGTGAACCCCTGGGGGG - Intronic
1177622329 21:23612339-23612361 GAATTACATAAAGCCCTGAGAGG + Intergenic
1181475120 22:23163315-23163337 GAATGGCATGAACCCGGAAGGGG - Exonic
1183464200 22:37971343-37971365 GAATGACATAAAACCCTTGGTGG + Intronic
1183995038 22:41626723-41626745 GAATGGCATGAACCCGGGAGGGG - Intronic
1184098823 22:42330931-42330953 GAATGAGATGGGCCACTCAGGGG - Intronic
950119005 3:10469546-10469568 GAATTCCCTGACCCCCTCAGGGG - Intronic
951272527 3:20644449-20644471 GAATGGCATGAACCCCGCTGCGG - Intergenic
951726728 3:25768336-25768358 GAATCACTTGAACCCGGCAGAGG + Intronic
956110259 3:65863197-65863219 GTATCACATGAGCTCCTCAGAGG - Intronic
956319935 3:67985503-67985525 GAATGGCATGAACCCGGGAGGGG - Intergenic
957262191 3:77916738-77916760 GAATGGCATGAACCCAGGAGGGG - Intergenic
957829667 3:85500603-85500625 GAATGACGTGAACCCTGGAGAGG - Intronic
958192170 3:90197247-90197269 GAATGGCATGAACCCGAGAGGGG - Intergenic
960503566 3:118466492-118466514 GAATCGCTTGAACCCCTGAGTGG - Intergenic
962499496 3:135975388-135975410 TAATAACATGAACCCACCAGAGG - Intronic
962580824 3:136796346-136796368 GAATGGCATGAACCCCAGGGCGG + Intergenic
962782073 3:138728690-138728712 GAATGGCATGAACCCGGGAGGGG + Intronic
964748148 3:160030903-160030925 GAATCACTTGAACCCCAAAGGGG - Intronic
966383076 3:179363189-179363211 GAATGGCTTGAACCCCGGAGGGG - Intronic
968159857 3:196417223-196417245 GAATGGCGTGAACCCGGCAGCGG + Intronic
969320573 4:6410008-6410030 GCATGACATGTGTCCCTCAGAGG + Intronic
973742378 4:53930581-53930603 GAATGACATCAAACCAACAGTGG + Intronic
975836655 4:78429402-78429424 GAAGGAAATGAAGCCTTCAGAGG + Intronic
977308072 4:95350397-95350419 GAATCACTTGAACCCTTGAGGGG + Intronic
979226870 4:118296072-118296094 GCAGCCCATGAACCCCTCAGAGG - Intronic
980055299 4:128073326-128073348 GAATGGCTTGAACCCCGGAGGGG + Intronic
980439006 4:132817086-132817108 GAATGGCATGAACCCGGGAGGGG - Intergenic
980973753 4:139590490-139590512 GAATGGCATGAACCCGGGAGGGG + Intronic
981581144 4:146249340-146249362 GAATGACATGAACCCGGGAGGGG + Intergenic
983820038 4:172181801-172181823 GAATGGCATGAACCCAGGAGTGG - Intronic
984374157 4:178905968-178905990 GAATGACGTGAACCCGGAAGCGG - Intergenic
985075206 4:186207319-186207341 GAATGACATGAACCCCTCAGGGG + Intronic
985889057 5:2701630-2701652 CAATGAGATGGAGCCCTCAGAGG - Intergenic
986406347 5:7428631-7428653 GAATGAAATTATCCCCTCACTGG - Intronic
987991364 5:25216872-25216894 GAATGACTTGAACCTGTGAGCGG + Intergenic
988282272 5:29165426-29165448 GAATGGCATGAACCCAGGAGGGG + Intergenic
991688955 5:69207719-69207741 GAATCACTTGAACCCCTGGGAGG + Intronic
993623424 5:90193751-90193773 GAGTGACATGAGCCCCTCTGTGG - Intergenic
995217412 5:109611757-109611779 GAGTGACATGAAATCCTCAACGG + Intergenic
996715582 5:126585208-126585230 GAATCACTTGAACCCCGGAGGGG + Intronic
998821629 5:146062763-146062785 GAATGGCAGGATGCCCTCAGTGG - Intronic
1001233784 5:170012649-170012671 AAATGCCATTAACCCCTGAGTGG - Intronic
1003629599 6:7774460-7774482 GAATCACTTGAACCCCTGGGAGG + Intronic
1003669232 6:8140166-8140188 GAATGACACGATCCCCTTTGTGG + Intergenic
1005216649 6:23536176-23536198 GAATGGCATGAACCCAGGAGTGG + Intergenic
1006694023 6:35915317-35915339 GAATGGCATGAACCCGGGAGGGG + Intronic
1007530019 6:42533851-42533873 GAATCACTTGAACCCGACAGAGG + Intergenic
1008702524 6:54117856-54117878 GAATGGCATGAACCCGGGAGTGG + Intronic
1010997492 6:82550467-82550489 GAATGGCATGAACCCAGGAGGGG - Intergenic
1013331158 6:109101705-109101727 GAATGGCGTGAACCCGGCAGCGG - Intronic
1014524189 6:122482046-122482068 GAATGGCGTGAACCCCAGAGGGG - Intronic
1016972037 6:149773464-149773486 GAATGGCATGAACCCGGAAGTGG - Intronic
1017011266 6:150065223-150065245 TAAGAACATGAACCCCTCATGGG - Intronic
1022396637 7:29992942-29992964 GAAGGACATGATCCCTACAGAGG + Intergenic
1025832063 7:65060862-65060884 GAATGGCATGAACCCGGGAGGGG + Intergenic
1025919745 7:65900300-65900322 GAATGGCATGAACCCGGGAGGGG + Intronic
1025990156 7:66491540-66491562 GAATCACTTGAACCCGGCAGGGG + Intergenic
1026014460 7:66662149-66662171 GAATGGCATGAACCCGGGAGGGG + Intronic
1027613737 7:80394687-80394709 GAATGGCATGAACCCAGGAGGGG + Intronic
1028118442 7:87028747-87028769 GAATGAGATGAAGGCCTTAGAGG - Intronic
1029439445 7:100578901-100578923 GAATGACTTGAGCCACCCAGGGG - Intronic
1030182733 7:106727166-106727188 GAATGGCGTGAACCCCGGAGGGG + Intergenic
1032130682 7:129225133-129225155 GAAGGACCTGAGCCCCTCCGAGG + Exonic
1032516962 7:132513760-132513782 GAATCACTTGAACCCCTGGGAGG - Intronic
1034296402 7:149976484-149976506 GAATGGCGTGAACCCATGAGAGG + Intergenic
1034809627 7:154120330-154120352 GAATGGCGTGAACCCATGAGGGG - Intronic
1034982226 7:155486469-155486491 GAATGGCATGAACCCAGGAGGGG + Intronic
1035005698 7:155658486-155658508 GAATCACTTGAACCCCGCGGAGG - Intronic
1037257616 8:16973036-16973058 GAATGGCATGAACCCAGGAGGGG - Intergenic
1039324416 8:36468663-36468685 GAATGGCATGAACCCAGGAGGGG + Intergenic
1040467003 8:47704760-47704782 GATTGGCATGAGTCCCTCAGTGG + Intronic
1041725320 8:61012556-61012578 TACTGACATGTAGCCCTCAGAGG + Intergenic
1042559752 8:70064610-70064632 GAATGGCGTGAACCCAGCAGGGG - Intronic
1043579798 8:81698998-81699020 GAATCACATGAACCCAGGAGGGG - Intergenic
1046306649 8:112376506-112376528 GAATGACGTGAAACTCTCAGTGG - Intronic
1049937851 9:516837-516859 GAAGGACAGGTACCCCCCAGCGG - Intronic
1050600907 9:7249547-7249569 GAATCACTTGAACCCCAGAGGGG - Intergenic
1050856514 9:10364085-10364107 GAATGGCATGAACCCGGGAGGGG - Intronic
1053156163 9:35781185-35781207 GAATAACATGACCCACTTAGAGG + Intergenic
1053175407 9:35918825-35918847 GTAAGACCTGACCCCCTCAGAGG - Intergenic
1053192310 9:36082534-36082556 GAAGAACAAGAACCCCTCACAGG - Intronic
1057541830 9:95980936-95980958 GACAGACATGAAGCACTCAGAGG - Intronic
1057639973 9:96809862-96809884 GAATGGCATGAACCCGGGAGGGG + Intergenic
1061564026 9:131425573-131425595 GAATGGCATGAACCCAGAAGGGG - Intronic
1061831257 9:133296746-133296768 GAATGGCATGAACCCGGGAGGGG - Intergenic
1190247078 X:48697433-48697455 GACTCTCCTGAACCCCTCAGAGG - Intronic
1191974649 X:66858654-66858676 GAATGACGTGAACCCAGGAGAGG + Intergenic
1191983909 X:66958312-66958334 GAATTACTTGAACCCAGCAGGGG - Intergenic
1193126842 X:77879142-77879164 GAATTGCATGAACCCAGCAGGGG - Intronic
1193795802 X:85871217-85871239 GAATGGCATGAACCCAGGAGGGG + Intronic
1198429761 X:136553658-136553680 GAACTACATGAACCTTTCAGTGG + Intronic
1201503518 Y:14672435-14672457 GAATGGCATGAACCCAGGAGGGG + Intronic
1202378606 Y:24258660-24258682 GCATGACATGTGCCTCTCAGCGG - Intergenic
1202492176 Y:25411461-25411483 GCATGACATGTGCCTCTCAGCGG + Intergenic