ID: 985076434

View in Genome Browser
Species Human (GRCh38)
Location 4:186219992-186220014
Sequence AAAAGGATCTCAAAGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 405}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985076432_985076434 -6 Left 985076432 4:186219975-186219997 CCTGTTGACTTAGAGGTAAAAGG 0: 1
1: 2
2: 54
3: 254
4: 344
Right 985076434 4:186219992-186220014 AAAAGGATCTCAAAGTGTCCAGG 0: 1
1: 0
2: 4
3: 63
4: 405
985076427_985076434 24 Left 985076427 4:186219945-186219967 CCACAGCCAACACTGCAACTCCC 0: 6
1: 142
2: 225
3: 188
4: 410
Right 985076434 4:186219992-186220014 AAAAGGATCTCAAAGTGTCCAGG 0: 1
1: 0
2: 4
3: 63
4: 405
985076430_985076434 3 Left 985076430 4:186219966-186219988 CCTTCTGAGCCTGTTGACTTAGA 0: 1
1: 24
2: 238
3: 190
4: 256
Right 985076434 4:186219992-186220014 AAAAGGATCTCAAAGTGTCCAGG 0: 1
1: 0
2: 4
3: 63
4: 405
985076428_985076434 18 Left 985076428 4:186219951-186219973 CCAACACTGCAACTCCCTTCTGA 0: 1
1: 6
2: 188
3: 245
4: 401
Right 985076434 4:186219992-186220014 AAAAGGATCTCAAAGTGTCCAGG 0: 1
1: 0
2: 4
3: 63
4: 405
985076429_985076434 4 Left 985076429 4:186219965-186219987 CCCTTCTGAGCCTGTTGACTTAG 0: 1
1: 32
2: 253
3: 228
4: 356
Right 985076434 4:186219992-186220014 AAAAGGATCTCAAAGTGTCCAGG 0: 1
1: 0
2: 4
3: 63
4: 405

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985076434 Original CRISPR AAAAGGATCTCAAAGTGTCC AGG Intronic
900280749 1:1866657-1866679 AAAAAAATCTCAATGTGGCCGGG + Intronic
901958986 1:12809843-12809865 AAAAAAATCTCACATTGTCCAGG - Intergenic
904232372 1:29086565-29086587 AAAAGGATCTTAAGGTGGCCGGG - Intronic
904664587 1:32109948-32109970 AAAAGGATTTCAAAGTGGCCGGG - Intronic
905417778 1:37816124-37816146 TAAAGGAGCTCAGAGTCTCCTGG - Intronic
905465466 1:38149775-38149797 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
906050716 1:42869078-42869100 AGGAGGAACCCAAAGTGTCCAGG - Intergenic
906930690 1:50166855-50166877 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
907607155 1:55829504-55829526 ACAGGGATCCCAAAGTGACCAGG + Intergenic
908524615 1:64975907-64975929 ACAAGGAATTCAAAGTGCCCTGG + Intergenic
908560294 1:65299752-65299774 ATAAATATCTGAAAGTGTCCAGG + Intronic
908617997 1:65944900-65944922 ATAAGGAGCCCAAAGTGACCAGG - Intronic
908737629 1:67292474-67292496 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
909577156 1:77187502-77187524 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
909858690 1:80575371-80575393 AGAAGGAGCCCAAAGTGGCCAGG + Intergenic
910588451 1:88903391-88903413 AGCAGGAGCCCAAAGTGTCCAGG - Intergenic
910630444 1:89347933-89347955 AGAAGGAGCCCAAAGTGTCCAGG - Intergenic
910830863 1:91461752-91461774 AGGAGGATCCCAAAGTGTCCAGG + Intergenic
911738176 1:101360265-101360287 AGGAGGGTCCCAAAGTGTCCAGG + Intergenic
911847982 1:102778777-102778799 AGAAGGATCTCCAAGTGCTCTGG - Intergenic
912056208 1:105601466-105601488 ATTAGCATCTCAAAGAGTCCAGG + Intergenic
912067233 1:105758622-105758644 AAGGGGAGCACAAAGTGTCCAGG - Intergenic
912103443 1:106240648-106240670 AAGAGGAAGTCAAATTGTCCCGG + Intergenic
912129689 1:106586389-106586411 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
912251804 1:108019811-108019833 AGGAGGACCCCAAAGTGTCCGGG + Intergenic
912726951 1:112067219-112067241 AAAATGAGGTGAAAGTGTCCTGG + Intergenic
912772733 1:112479626-112479648 AACAAGATCACAAAGTGTGCAGG + Intronic
913493698 1:119406820-119406842 AAAAGAACCTCAAGGTGTACAGG + Intergenic
914410986 1:147427275-147427297 AAGAGGAAGTCAAATTGTCCCGG + Intergenic
914459996 1:147874960-147874982 AAGAGGAAGTCAAATTGTCCCGG - Intergenic
915057012 1:153142410-153142432 AAGAGGAAGTCAAATTGTCCCGG - Intergenic
915667442 1:157458026-157458048 AAGAGGAGCCTAAAGTGTCCAGG + Intergenic
916285556 1:163101182-163101204 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
917062357 1:171055215-171055237 AAAAGGATCTCCAGTTATCCAGG - Intronic
917136349 1:171791757-171791779 TTAAAGATCTCAAAGTGGCCAGG - Intronic
917764764 1:178203678-178203700 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
918768686 1:188523522-188523544 AGGAGGATCCAAAAGTGTCCAGG - Intergenic
918815272 1:189172863-189172885 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
918918012 1:190670215-190670237 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
919241990 1:194925868-194925890 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
919501815 1:198346850-198346872 ATAAGGAGCCCAAAATGTCCAGG - Intergenic
919645994 1:200095139-200095161 AAAAAGATCTCACTGTTTCCCGG + Intronic
922067868 1:222161429-222161451 AATATGGTCTCAAAATGTCCTGG - Intergenic
923260350 1:232262018-232262040 AAGAGGATCTGCAAGTGTGCGGG + Intergenic
924705412 1:246497635-246497657 AAAAGAATCTCAAAGTGAGTGGG + Intronic
924829700 1:247580004-247580026 ACAAAGAGCTCAAAGTGGCCAGG - Intergenic
1063788356 10:9410177-9410199 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1064517355 10:16166114-16166136 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1064784455 10:18878389-18878411 ATAAGGATCCCAAGGGGTCCAGG - Intergenic
1065787585 10:29230499-29230521 AGAAGGATCTAAGAGTCTCCAGG - Intergenic
1067754128 10:48992047-48992069 TGAAGGAGCCCAAAGTGTCCAGG + Intergenic
1068856857 10:61806550-61806572 ACAAGGAACCCAAAGTGGCCGGG - Intergenic
1069115085 10:64494745-64494767 AAAAAGACCTCAACCTGTCCAGG - Intergenic
1069790593 10:71017913-71017935 AGGAGGATCCCAAACTGTCCAGG + Intergenic
1070289808 10:75106811-75106833 AAAAGAATGTCAAAGTGTGTTGG + Intronic
1071942551 10:90606113-90606135 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1072209029 10:93230042-93230064 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1074822828 10:117194303-117194325 ACGAGGATCCCAAAGTGCCCAGG - Intergenic
1074906010 10:117864507-117864529 AAAAGGTCCTTTAAGTGTCCAGG + Intergenic
1076110335 10:127855225-127855247 AAATGGCTCTAAAAGTGTCTTGG + Intergenic
1076271536 10:129156475-129156497 ATGAGGAGCCCAAAGTGTCCAGG - Intergenic
1078025794 11:7694386-7694408 AAGAGGGTCTTAAGGTGTCCTGG - Intronic
1078331704 11:10427757-10427779 GAAAGAATCTCAAAGACTCCAGG + Intronic
1078961967 11:16286220-16286242 AAAAGCATCTCAGTGTGTACTGG + Intronic
1080076827 11:28159159-28159181 AGGAGGAACCCAAAGTGTCCAGG - Intronic
1080464442 11:32483611-32483633 AAAATGATGTCAAATTGGCCAGG - Intergenic
1081110756 11:39130385-39130407 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1081609297 11:44549531-44549553 ACGAGGAGCCCAAAGTGTCCAGG - Intergenic
1082671914 11:56044672-56044694 AGGAGGGTCCCAAAGTGTCCAGG - Intergenic
1082999878 11:59281507-59281529 AGGAGGAGCTCAAAGTGTCCAGG - Intergenic
1084102260 11:66957634-66957656 AAAAGAATCTCAAAGTTGCCAGG + Intronic
1084302383 11:68260031-68260053 AAAAGGATGTCAAAGGGCCTGGG - Intergenic
1085686193 11:78623832-78623854 AAGAGGAGCCCAAAGTGTCCAGG - Intergenic
1085748556 11:79137210-79137232 GGAAGGAGCTCAAAATGTCCAGG - Intronic
1086141401 11:83504532-83504554 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1088097427 11:106116804-106116826 AGAAGGAGCCCAAAGTGGCCAGG - Intergenic
1088191446 11:107233043-107233065 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1088449574 11:109966994-109967016 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1090209257 11:124906412-124906434 AGGAGGAACCCAAAGTGTCCAGG + Intergenic
1090314314 11:125771504-125771526 ACAGGGAGCTCAAATTGTCCAGG + Intergenic
1090753795 11:129770949-129770971 ATAAGGACCCCAAAGTGGCCAGG + Intergenic
1091051970 11:132380383-132380405 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1091589611 12:1835593-1835615 TAGAGGATCTCAAAGGATCCTGG - Exonic
1092093854 12:5825595-5825617 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1093017418 12:14169014-14169036 CAAGGTCTCTCAAAGTGTCCTGG + Intergenic
1093031583 12:14293972-14293994 AGGAGGAGCTCAAAGTGTCCAGG + Intergenic
1093048696 12:14483440-14483462 AAGAGGAGCCCAAAGTGTCCAGG + Intronic
1093049443 12:14489340-14489362 AGGAGGATCCCAAAGTATCCAGG + Intronic
1093964766 12:25312571-25312593 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1094102759 12:26780906-26780928 AGGAGGAACCCAAAGTGTCCAGG - Intronic
1094335415 12:29345376-29345398 AAAAGCATTTTAAAGTTTCCTGG - Intronic
1094389559 12:29934576-29934598 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1095604124 12:44046285-44046307 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1096061513 12:48704513-48704535 AAAAGCACCTCAAGGTGGCCGGG + Intronic
1096289000 12:50324896-50324918 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1097821115 12:64130272-64130294 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1098625122 12:72656496-72656518 CAAAGGATCTGACAGTGCCCAGG + Intronic
1098673247 12:73255891-73255913 AAGAGGAGCCCAAAGTGTCCAGG - Intergenic
1098750053 12:74281238-74281260 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1099183164 12:79490957-79490979 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1099366148 12:81767027-81767049 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1099490454 12:83282609-83282631 AAGAGGAGACCAAAGTGTCCAGG + Intergenic
1099578279 12:84407042-84407064 AGGAGGAACCCAAAGTGTCCAGG - Intergenic
1099700658 12:86077915-86077937 AGAAGGAGCCCAAAATGTCCAGG + Intronic
1100240912 12:92709960-92709982 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1102016608 12:109652070-109652092 AACATGGTCTCAGAGTGTCCTGG + Intergenic
1103035861 12:117655712-117655734 AGGAGGAGCTCAAAGTGTCCAGG - Intronic
1105740348 13:23316822-23316844 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1108904495 13:55451603-55451625 AGGAGGAGCACAAAGTGTCCAGG - Intergenic
1109583315 13:64368138-64368160 AGGAGGATCCCAAAGTGTCCAGG - Intergenic
1109950799 13:69500572-69500594 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1111363394 13:87207360-87207382 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1111535422 13:89596812-89596834 AGGAGGAACCCAAAGTGTCCAGG - Intergenic
1111636494 13:90911039-90911061 TAAATGATCTCAATGTTTCCTGG - Intergenic
1112875869 13:104037551-104037573 AAGAGGAGCCCAAAGTGTCCAGG + Intergenic
1114206091 14:20572413-20572435 AGGAGGAGCCCAAAGTGTCCGGG - Intergenic
1114397075 14:22373834-22373856 AAAAGAAACTCAAAGTTCCCAGG + Intergenic
1115130908 14:30050905-30050927 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1116059122 14:39898562-39898584 AGAAGGAGCCCAAAGTGTCCAGG - Intergenic
1116066852 14:39995537-39995559 AAAAAGAATTTAAAGTGTCCTGG - Intergenic
1116415298 14:44671008-44671030 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1117856409 14:60038713-60038735 AAGAGGAAGTCAAATTGTCCCGG - Intronic
1117967109 14:61217453-61217475 AAAAGGAACTCATAGTGTAGAGG + Intronic
1118449869 14:65890578-65890600 AAGAGGGGCTCAAAGTGTGCAGG + Intergenic
1119057666 14:71439614-71439636 AAAAGAATATTAAAGTGTCATGG + Intronic
1119059473 14:71460549-71460571 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1120081794 14:80225888-80225910 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1120350576 14:83352586-83352608 AGGAGGACCCCAAAGTGTCCAGG - Intergenic
1120555793 14:85928994-85929016 AGGAGGAGCTCAAAGTTTCCAGG + Intergenic
1121077190 14:91078780-91078802 AAAATGATCTTTAACTGTCCAGG + Intronic
1121423793 14:93833894-93833916 GAATGGTTCTGAAAGTGTCCCGG - Intergenic
1125408867 15:39383971-39383993 AAAAGGTTCACAAAGTGTGGGGG - Intergenic
1126178839 15:45765293-45765315 ATAAGGAGCCCAGAGTGTCCAGG + Intergenic
1127339912 15:58030584-58030606 AAGAGGAAGTCAAATTGTCCCGG + Intronic
1127599534 15:60521580-60521602 AAAAGGAAGTCAAAGTCTTCGGG - Intronic
1127949544 15:63791175-63791197 AAAACTATCTCAGAGTGTCTGGG - Intronic
1129591708 15:76920877-76920899 ACAAGGAACCCAAAGTGTCAAGG + Intergenic
1130037637 15:80376290-80376312 AAAAGAATGTAAAAGAGTCCAGG - Exonic
1134259498 16:12639609-12639631 AAAAGGATTGAAAAGTGGCCAGG - Intergenic
1135855625 16:26007519-26007541 AACACTATCTGAAAGTGTCCCGG + Intronic
1138364847 16:56466639-56466661 AATAAGTTCTCAAAGTTTCCTGG - Intronic
1138775701 16:59721204-59721226 AAAAACATCTCAAAGTGTAGTGG - Intronic
1138868606 16:60852418-60852440 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1141559308 16:84856392-84856414 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1141567505 16:84912944-84912966 AAAAAGACATCAAAGCGTCCTGG - Intronic
1141744994 16:85919709-85919731 GAAAGGGTCTCAAAGTGGGCCGG - Intronic
1150550823 17:66208222-66208244 AAAAGGAGCCCAAAGTTGCCAGG - Intergenic
1151037582 17:70819976-70819998 AGGAGGATCCCAAAGTGTCCAGG + Intergenic
1152597358 17:81244325-81244347 AAAAGGATATCAAAAGGTGCAGG + Intergenic
1153089949 18:1331803-1331825 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1153668135 18:7384678-7384700 AAAAATATATCAATGTGTCCTGG + Intergenic
1154068689 18:11132725-11132747 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1154252332 18:12755116-12755138 AAGAGGAGCCCAAAATGTCCAGG + Intergenic
1155624600 18:27819955-27819977 AAAAGGAGATCACAGTGTGCAGG + Intergenic
1156443396 18:37215097-37215119 AAGAGGAAGTCAAATTGTCCAGG - Intronic
1156491098 18:37496674-37496696 AAAACAATCTCACACTGTCCTGG + Intronic
1156537794 18:37880566-37880588 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1156990087 18:43399140-43399162 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1157336838 18:46746261-46746283 AAGAGGAAATCAAATTGTCCCGG + Intronic
1157341437 18:46781655-46781677 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1157998280 18:52586482-52586504 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1158007067 18:52684775-52684797 TAAAGGATCTTCAAGTGTACAGG + Intronic
1158676705 18:59526602-59526624 AAAAAGATCTCCAATTGGCCGGG - Intronic
1159288002 18:66377113-66377135 AGGAGGAGCTCAAAGTGTCCAGG - Intergenic
1159391656 18:67801256-67801278 CAAAGGAGGTCAAAGTCTCCTGG + Intergenic
1159631527 18:70754221-70754243 AAAAGAGTTTCAAAGTGTCCAGG - Intergenic
1159637260 18:70820624-70820646 AAAAGTATCTTCAAGTCTCCTGG + Intergenic
1160092667 18:75841644-75841666 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1160433099 18:78825814-78825836 AAGAGGAGCTCACTGTGTCCTGG - Intergenic
1161634978 19:5382450-5382472 AAAAGTATCTCACTGTGGCCGGG - Intergenic
1162012661 19:7827676-7827698 AAAATGGAATCAAAGTGTCCTGG + Intergenic
1164271552 19:23677226-23677248 AAGAGGAACTCAAACTATCCCGG + Intronic
1165497370 19:36161052-36161074 ACAAGGACCTCAAAATGTTCAGG + Intergenic
1166978481 19:46619080-46619102 AAAAGGAAACCAAGGTGTCCCGG + Intergenic
1167237816 19:48325705-48325727 AAAAGGATTTCCAAGAGTCAGGG - Intronic
1168539105 19:57195770-57195792 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
925228345 2:2206379-2206401 AAAAGGATTTCCAAGTGGGCTGG - Intronic
925280185 2:2678492-2678514 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
925460964 2:4062088-4062110 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
925616640 2:5749804-5749826 AAAATGATCTTAAAATGTCAAGG - Intergenic
925772518 2:7297376-7297398 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
926733011 2:16051385-16051407 ACAAGGCTTTCAATGTGTCCAGG + Intergenic
928285558 2:29987272-29987294 AAAGGGATCTTTGAGTGTCCAGG + Intergenic
928719092 2:34098491-34098513 AAAAGGAACTGAAGATGTCCAGG + Intergenic
930536397 2:52650621-52650643 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
930869139 2:56152115-56152137 AAAAGGATATATGAGTGTCCAGG - Intergenic
930910358 2:56622508-56622530 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
933504557 2:83161127-83161149 ATGAGGAGCCCAAAGTGTCCAGG + Intergenic
933682468 2:85114236-85114258 ACAAGGATCCCAAAGTGACTAGG - Intergenic
934604993 2:95687849-95687871 GAAAGGATCTCAAGGAGTCCAGG - Intergenic
935184170 2:100716513-100716535 AGAAGGATCCCAAAGTGGCCAGG - Intergenic
935424881 2:102909692-102909714 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
935759939 2:106311165-106311187 AAAAGGATTGCAAAGTCACCTGG + Intergenic
936538442 2:113330388-113330410 GAAAGGATCTCAAGGAGTCCAGG - Intergenic
937765857 2:125659639-125659661 AGGAGGAACCCAAAGTGTCCAGG - Intergenic
937784981 2:125886087-125886109 AGAAGGAGCTCAAAGTGTCCAGG + Intergenic
937852350 2:126647110-126647132 AGGAGGATCCCAAAGTGTCCAGG + Intergenic
939788452 2:146544470-146544492 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
940471863 2:154111479-154111501 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
941034651 2:160555054-160555076 ACAAGGAGCTCAAAATGACCAGG + Intergenic
941387014 2:164866244-164866266 AGAAGGAGCCAAAAGTGTCCAGG - Intergenic
942403118 2:175624204-175624226 AAAAGGACTTCAATTTGTCCAGG - Intergenic
943021158 2:182575396-182575418 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
943833392 2:192489487-192489509 AGAAGGAACCCAAAGTGTCCAGG + Intergenic
944071029 2:195669300-195669322 ATAAAGATCTCACAGTGTTCTGG + Intronic
944939544 2:204608651-204608673 ACAGGGATCTCAAATTATCCAGG + Intronic
945066040 2:205948625-205948647 AAGTGGCTCTCAGAGTGTCCCGG - Intergenic
945725625 2:213469858-213469880 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1169452737 20:5726122-5726144 GACAGGATCTCAAATTGCCCAGG - Intergenic
1170592676 20:17782877-17782899 AAGATGATCTCCAATTGTCCTGG + Intergenic
1171457117 20:25278420-25278442 AACAGGTTCTCACAGGGTCCCGG - Exonic
1172238010 20:33391269-33391291 AAAAGGATGACAGAGTGTGCTGG + Intronic
1173915400 20:46704536-46704558 AAAAAGATCTCAAAGTAAGCTGG + Intergenic
1174403520 20:50289146-50289168 AAAAGCATCTTAGAGTCTCCTGG - Intergenic
1177267937 21:18808581-18808603 AAAAGGAGACCAAAGTGTCCAGG - Intergenic
1177505337 21:22012578-22012600 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1177749606 21:25263748-25263770 AAAAGGATCTGAAACTCGCCAGG - Intergenic
1177936024 21:27347432-27347454 AATAGCATCTCAAATTGTCAGGG - Intergenic
1178061917 21:28862001-28862023 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1178201559 21:30412928-30412950 AAAAGGATCTCAAATAGCCAAGG + Intronic
1179414912 21:41190891-41190913 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1179555980 21:42176426-42176448 AAAAGGATCACAAGGTGACTGGG + Intergenic
1181373492 22:22437537-22437559 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1181429675 22:22871470-22871492 GACAGGAGCTCATAGTGTCCAGG + Intronic
949125432 3:441450-441472 AAGAGGAGTCCAAAGTGTCCAGG + Intergenic
949246103 3:1926538-1926560 AGGAGGACCCCAAAGTGTCCAGG - Intergenic
949265093 3:2147825-2147847 AAATGGATCTCACAATTTCCAGG + Intronic
949354376 3:3162687-3162709 AAAAGGAACTTAAAGTATCGAGG - Intronic
949417360 3:3829268-3829290 AGAGGGAGCCCAAAGTGTCCAGG + Intronic
949425641 3:3912980-3913002 AAGAGGAAGTCAAATTGTCCTGG + Intronic
949639131 3:6015163-6015185 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
950160000 3:10753207-10753229 AAACTGATCTCAAAGTGTGCCGG - Intergenic
950315727 3:12000457-12000479 GGAAGGATCTCAAAGAGTCCTGG + Intergenic
951097299 3:18646822-18646844 AAAAGAATCTCATAGTGTTAGGG + Intergenic
951335078 3:21410611-21410633 AAAAAAATCTGAGAGTGTCCTGG - Intergenic
951384749 3:22029159-22029181 AGGAGGAGCACAAAGTGTCCAGG - Intronic
954054439 3:48009906-48009928 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
954511267 3:51128047-51128069 AGGAGGATCCCAAAGTGTCCAGG + Intronic
955658840 3:61275208-61275230 AAAAGGAACTCAAAGAGTTCAGG + Intergenic
956307088 3:67837273-67837295 AGAAGGAGCCCAAAGTGTCCAGG - Intergenic
956360378 3:68440874-68440896 TAGAGGAGCCCAAAGTGTCCAGG + Intronic
956703674 3:71981258-71981280 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
957423069 3:79997444-79997466 AAAAGAATGTCATAATGTCCTGG + Intergenic
957679314 3:83411751-83411773 TTAAGGATCTCATAGTTTCCTGG + Intergenic
957754805 3:84471071-84471093 AGAAGGAGCACAAAGTGTCCAGG - Intergenic
957873361 3:86114612-86114634 ACACTGGTCTCAAAGTGTCCTGG - Intergenic
959296293 3:104538906-104538928 AAAAGGAAATTAAACTGTCCTGG + Intergenic
959434840 3:106301860-106301882 ACAAGGATCCTAAAGTCTCCTGG - Intergenic
959745793 3:109775635-109775657 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
960349741 3:116577344-116577366 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
960494524 3:118359118-118359140 AGGAGGAGCACAAAGTGTCCAGG + Intergenic
961237709 3:125381902-125381924 AAAAGGAGCTCAGTGTGTTCAGG + Intergenic
963379022 3:144505642-144505664 AGGAGGAGCTCAAAGTGTCCAGG + Intergenic
963630532 3:147724858-147724880 AGGAGGAACCCAAAGTGTCCAGG - Intergenic
963970088 3:151420316-151420338 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
964146733 3:153472980-153473002 AGGAGGATCCCAAAGTGTCCAGG - Intergenic
965396980 3:168171723-168171745 AAAAGGTTCACAAAGAGGCCGGG - Intergenic
966445915 3:180000213-180000235 AGGAGGAGCTCAAAGTGTCCAGG - Intronic
966726193 3:183111013-183111035 AAAAGCATGTCAAATTGTACTGG - Intronic
967832018 3:193927628-193927650 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
970644851 4:18108330-18108352 AAGAGGAGCCCAAAGTGGCCAGG + Intergenic
970729724 4:19088675-19088697 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
971687157 4:29785451-29785473 AGGAGGAACCCAAAGTGTCCAGG + Intergenic
972806155 4:42531017-42531039 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
972943313 4:44223342-44223364 AAAGGTATCTCAAAGTTACCAGG - Intronic
973092801 4:46158724-46158746 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
973103139 4:46296386-46296408 AGCAGGAACCCAAAGTGTCCAGG - Intronic
973546849 4:51990809-51990831 AGATGGATCTCAGAGTGTCAAGG + Intergenic
974459231 4:62165895-62165917 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
976467544 4:85387920-85387942 AAAAGGATGACAAAATGTCCAGG + Intergenic
976518630 4:86001310-86001332 AAAAGCAGCTCAAAGGTTCCTGG - Exonic
977430989 4:96929836-96929858 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
977489866 4:97698437-97698459 AGGAGGAGCACAAAGTGTCCAGG + Intronic
977833001 4:101616200-101616222 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
978203876 4:106056238-106056260 AAAAAGACCTTAAAGTCTCCAGG - Intronic
978341344 4:107723908-107723930 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
978898841 4:113925185-113925207 AGGAGGAACCCAAAGTGTCCAGG + Intronic
979051885 4:115945206-115945228 ATAAGGAGCCCAAAGTGGCCAGG - Intergenic
979507342 4:121513658-121513680 AGGAGGAACCCAAAGTGTCCAGG + Intergenic
980405671 4:132352151-132352173 AGAAGAAGCTAAAAGTGTCCAGG + Intergenic
980513688 4:133825546-133825568 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
980602438 4:135041647-135041669 AGGAGGAGCGCAAAGTGTCCAGG - Intergenic
980878253 4:138683901-138683923 AAAAGCATCCAAAAGTGTACTGG + Intergenic
981463034 4:145033419-145033441 AAGAGGAGCCCAAAGTGTACAGG - Intronic
981835226 4:149045544-149045566 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
983027629 4:162756926-162756948 AAGAGGATCCCAAAGTGTCCAGG - Intergenic
983582911 4:169326456-169326478 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
984060062 4:174980395-174980417 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
985076434 4:186219992-186220014 AAAAGGATCTCAAAGTGTCCAGG + Intronic
985832541 5:2244960-2244982 AGGAGGAGCTCAAAGTGTCCAGG - Intergenic
986036820 5:3948811-3948833 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
986743175 5:10721408-10721430 AATAAGAGCCCAAAGTGTCCAGG - Intronic
987192788 5:15496685-15496707 AACATGATATGAAAGTGTCCAGG - Intergenic
987466324 5:18276105-18276127 AGAAGGAGCTCAAAGTGGCCAGG - Intergenic
987468023 5:18295720-18295742 GGAAGGAGCCCAAAGTGTCCAGG + Intergenic
987472531 5:18350901-18350923 AAAAGGCTGTGAAAGTGTCTGGG + Intergenic
987504611 5:18751480-18751502 AAGAGGAGCCCAAAGTGTCCAGG - Intergenic
988092652 5:26562934-26562956 AAGAGGAGCCCAAAGTGTCCAGG - Intergenic
988150800 5:27376844-27376866 GACAAGATCTCAAAGTGTCAGGG - Intergenic
989044922 5:37265641-37265663 AGGAGGAGCGCAAAGTGTCCAGG + Intergenic
990456603 5:55994945-55994967 AGAAGGATCTGACAGTGTTCCGG - Exonic
990748112 5:58981994-58982016 ATAAGGAGCTCAAAGTGGCTAGG + Intronic
991013562 5:61909251-61909273 AAGAGGAGCCCAAAGTGTCCAGG + Intergenic
991033783 5:62107562-62107584 AAGAGGAGCCCAAAGTGTTCAGG - Intergenic
991330523 5:65488081-65488103 AGGAGGAGCTCAAAGTGTCCAGG + Intergenic
991946371 5:71901764-71901786 AGGAGGAACCCAAAGTGTCCAGG - Intergenic
992109645 5:73481054-73481076 ATGAGGAACCCAAAGTGTCCAGG + Intergenic
992573360 5:78083110-78083132 AATAGGTTCTCAACGTGGCCGGG - Intronic
993132691 5:83919270-83919292 AAAAGGAGCCCAAAGTGGCTGGG - Intergenic
993203620 5:84849182-84849204 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
993367116 5:87048223-87048245 AGGAGGATCCCAAAGTGTCCAGG + Intergenic
993439908 5:87943857-87943879 AAAGGGATCACAAAGTGTTATGG - Intergenic
994291145 5:98030316-98030338 ATGAGGAGCCCAAAGTGTCCAGG + Intergenic
994837169 5:104870841-104870863 AGCAGGAGCCCAAAGTGTCCAGG - Intergenic
995845241 5:116486903-116486925 GGGAGGATCTCAAAGAGTCCTGG - Exonic
996386102 5:122912417-122912439 AAGAGGAAGTCAAATTGTCCCGG - Intronic
997920314 5:137972654-137972676 AAGAGGAAGTCAAATTGTCCCGG + Intronic
999884879 5:155911137-155911159 AATAGTGTCTCAAAGTATCCAGG + Intronic
1000332119 5:160213909-160213931 AGAAGGATCTCAAGGAGCCCAGG - Intronic
1000499341 5:162029635-162029657 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1003602780 6:7533259-7533281 AAAAGGCTCTGAAAGTGACAAGG - Intergenic
1003695668 6:8404522-8404544 AGAAGGAGCCCAAAGTGTCCAGG + Intergenic
1004536639 6:16509546-16509568 AGAAGGATCAGAAGGTGTCCAGG - Intronic
1004821714 6:19374705-19374727 ACAAGAATGTCAAAGTGCCCAGG - Intergenic
1004945576 6:20609190-20609212 AAAAGGTGCTCCAAGAGTCCAGG - Intronic
1006001775 6:30970707-30970729 AGAAGGAGCCCAAAGTGTCCAGG - Intergenic
1006986240 6:38177531-38177553 AAAAAGACCTCAGAGTGGCCTGG + Intronic
1007224982 6:40307316-40307338 AAAAGGCCCTCAAAGTGGCTTGG - Intergenic
1007538462 6:42618357-42618379 TCAAGGATCTTCAAGTGTCCTGG - Intronic
1008292322 6:49732126-49732148 AAATAGATATCAAAGTGTTCTGG + Intronic
1008340477 6:50357918-50357940 AGGAGGAGCTCTAAGTGTCCAGG - Intergenic
1008820615 6:55626770-55626792 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1009613856 6:65980291-65980313 AAAAGGAAAGCCAAGTGTCCAGG - Intergenic
1009806706 6:68608587-68608609 AGAAGGAGCCCAAAGTGTCCAGG - Intergenic
1010291916 6:74147401-74147423 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1010299905 6:74247375-74247397 AAGAGGAAGTCAAATTGTCCCGG + Intergenic
1010320110 6:74497107-74497129 AAGAGGAAGTCAAATTGTCCCGG - Intergenic
1010818854 6:80390043-80390065 AAGAGGACCCCAAAGTGTCCAGG - Intergenic
1011815747 6:91188165-91188187 AAAAGGAAGTCAAATTGTCCCGG - Intergenic
1012344806 6:98171924-98171946 AGGAGGATCCCAAAGTGTCCAGG - Intergenic
1013234133 6:108182259-108182281 AAAAGAAGCTCAAAGTGTAATGG + Intronic
1014098965 6:117488680-117488702 AAAAGGGTCTCAGAGATTCCCGG - Intronic
1014533965 6:122594959-122594981 AGAAGGACCCCAAAGTGTCCAGG + Intronic
1015219872 6:130792113-130792135 AAAAGAATCTCAAAATCTCAAGG + Intergenic
1015443056 6:133270909-133270931 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1016157810 6:140834639-140834661 ATAAGGAGCACAAAATGTCCAGG - Intergenic
1016594794 6:145787148-145787170 AGGAGGAACCCAAAGTGTCCAGG + Intergenic
1017653934 6:156608869-156608891 AAAAGGAAGTCAAATTGTCCTGG + Intergenic
1018778142 6:167037709-167037731 AAAAGCATCTCACAGTATCTCGG + Intronic
1018880645 6:167876293-167876315 AAAAAGATCTCAGAGAGTACGGG + Intronic
1018961261 6:168450665-168450687 AAAAGGAACTGAAAGTGTCAGGG - Intronic
1019092490 6:169551009-169551031 AAAAATAACTCAAAATGTCCAGG - Intronic
1020199903 7:6071568-6071590 AAGAGGAACTGAAAGTGGCCAGG + Intergenic
1020567547 7:9817214-9817236 AAGAGGAGCCCAAAGTGTCCAGG + Intergenic
1020710533 7:11598914-11598936 AGAAGGAGCCCAAAGTGTCCAGG - Intronic
1021489644 7:21205032-21205054 AAAAGGTTCTAAAAGTTTTCTGG + Intergenic
1021989046 7:26124566-26124588 AGGAGGATCCCAAAGTGTCCAGG - Intergenic
1022153742 7:27638098-27638120 AAAAGGAGCTCAAATAGTCAAGG + Intronic
1024012202 7:45278477-45278499 GAAAGGGTCCCAAAGTGGCCTGG - Intergenic
1024744436 7:52390068-52390090 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1025735216 7:64140876-64140898 AAAGTGATCTCAGAGTCTCCTGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026593102 7:71713012-71713034 AAAAGCATCTTCAAGGGTCCTGG - Exonic
1028044061 7:86093104-86093126 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1028238098 7:88384770-88384792 AGAAGGAGCCCAAAGTGTCCAGG - Intergenic
1029297563 7:99553485-99553507 ACAAGAAACTCAAAGTGGCCTGG + Intronic
1030277775 7:107738276-107738298 AATAGGAGCCCAAAGTGTCCAGG - Intergenic
1030457234 7:109791422-109791444 AGGAGGAACCCAAAGTGTCCAGG + Intergenic
1030883059 7:114904901-114904923 AGGAGGAGCCCAAAGTGTCCGGG + Intergenic
1031237083 7:119189902-119189924 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1031474225 7:122203716-122203738 AAGAGGAGCTCAAAGTGTCCAGG + Intergenic
1031767988 7:125805324-125805346 ATGAGGAGCTCAAAGTGGCCAGG - Intergenic
1031833237 7:126651659-126651681 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1031861296 7:126983092-126983114 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1032152869 7:129445333-129445355 AGGAGGACCCCAAAGTGTCCAGG + Intronic
1032914607 7:136475687-136475709 AAAAGGAAGTCAAATTATCCCGG - Intergenic
1032923257 7:136574500-136574522 AGGAGGACCCCAAAGTGTCCAGG + Intergenic
1034076806 7:148239863-148239885 AGAAGGTTCTCAAGATGTCCAGG + Intronic
1034149727 7:148905471-148905493 AACAGGATCTCACAGCCTCCGGG - Intergenic
1034170092 7:149056224-149056246 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1038050679 8:23807606-23807628 AAAATCATCTCAAATTTTCCTGG - Intergenic
1038120216 8:24604760-24604782 AAAAGGATGTCCTAGTGTCTTGG + Intergenic
1038206334 8:25469691-25469713 AAGTGTATCTCAAAGTGTACAGG - Intronic
1038454230 8:27662014-27662036 ATAAGGAGCTCAAAGTGGCCAGG + Intronic
1038819853 8:30942386-30942408 AAAAGGATATCAAAGACTCTTGG - Intergenic
1039066157 8:33609908-33609930 AAGAGGAGCTCAAAGAGTCTTGG + Intergenic
1039270729 8:35877422-35877444 AACATGATCTCACAGTGTGCAGG - Intergenic
1039323961 8:36464909-36464931 AGGAGGAGCTCAAAGTGTCCAGG + Intergenic
1039729872 8:40262946-40262968 CAAAGGATCTCAAAATGTAAGGG - Intergenic
1040793911 8:51268747-51268769 AAGAGGAGCCCAAAGTGGCCAGG + Intergenic
1041232050 8:55763372-55763394 AAAATTATCTCAATGTGACCTGG - Intronic
1041803237 8:61822563-61822585 AAAAGGATCTCTAAGTGCAATGG - Intergenic
1041986408 8:63926113-63926135 AGAAGGAGCCAAAAGTGTCCAGG - Intergenic
1042000835 8:64122355-64122377 AGAAGGTGCCCAAAGTGTCCAGG + Intergenic
1042355959 8:67827854-67827876 AAAAGGATCACAAAGGGTGGAGG + Intergenic
1043105503 8:76104788-76104810 AGGAGGAACCCAAAGTGTCCAGG + Intergenic
1044486943 8:92765541-92765563 AAGAGGAGCCCAAAGTTTCCAGG + Intergenic
1044632918 8:94296770-94296792 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1045222000 8:100208205-100208227 AGGAGGAGCACAAAGTGTCCAGG - Intronic
1045266928 8:100626849-100626871 AAAAGGATATAAAAGTGAGCTGG + Intronic
1045670271 8:104543568-104543590 ATAATGATCTCTAAGTGTTCAGG + Intronic
1046128423 8:109939731-109939753 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1046417431 8:113936163-113936185 ATCAGGAGCCCAAAGTGTCCAGG + Intergenic
1046598155 8:116285764-116285786 AAAAGGGTCACAAAGTTTCAAGG + Intergenic
1048670616 8:136715129-136715151 AAAAGGATCTCAAAAAATGCAGG - Intergenic
1048943343 8:139422181-139422203 CTGAGGAGCTCAAAGTGTCCAGG - Intergenic
1049311468 8:141935995-141936017 AAAACGAGCCCAAAGTGACCCGG - Intergenic
1049538744 8:143195770-143195792 AGGAGGGGCTCAAAGTGTCCAGG - Intergenic
1050592831 9:7177893-7177915 AAAGGGACCTCAAAGTTGCCCGG - Intergenic
1050723755 9:8622043-8622065 AAAATGATTTTAAAGTGTACTGG - Intronic
1050952082 9:11610285-11610307 TACAGGATCTCCATGTGTCCTGG + Intergenic
1051605460 9:18913855-18913877 AAAAGCATCTCCAAGTGAACTGG - Intergenic
1051802523 9:20952123-20952145 GCAGGGATCTCACAGTGTCCTGG + Intronic
1051882181 9:21850910-21850932 AGGAGGAGCCCAAAGTGTCCAGG - Intronic
1052227804 9:26110019-26110041 AGGAGGAGCCCAAAGTGTCCAGG - Exonic
1052538076 9:29773404-29773426 AAAAGGATATCAGATTGTCTAGG + Intergenic
1052895298 9:33741977-33741999 ATGAGGATCCCAAAGTGGCCAGG + Intergenic
1053397862 9:37790889-37790911 AAAAGGGTCTCAATCTGCCCTGG - Intronic
1053469781 9:38338004-38338026 TAAATGACCTCAAAGTGTCTGGG - Intergenic
1055103331 9:72487350-72487372 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1057100371 9:92353620-92353642 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1058369173 9:104245019-104245041 AAATGGATCACAAAGTGATCTGG - Intergenic
1058543954 9:106041115-106041137 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1059201288 9:112419506-112419528 AAAAGATTCTTAAAGTGTTCCGG - Intronic
1059266214 9:113033840-113033862 ACAAAGAGCTCAAAGTATCCAGG - Intergenic
1061452017 9:130672751-130672773 AAAAGGATCTCAATGTCATCTGG - Intronic
1186199775 X:7145644-7145666 AAAAGCATGGGAAAGTGTCCTGG + Intronic
1186279737 X:7978755-7978777 AGAAGGAGCCCAAAGTGTCCTGG - Intergenic
1187524139 X:20038745-20038767 AGGAGGAGCTTAAAGTGTCCAGG - Intronic
1187878697 X:23826294-23826316 AAAAGGGTATCAAAGGGTACAGG + Intergenic
1188339481 X:28981342-28981364 AAAATGATCTAAAAATCTCCTGG + Intronic
1189596622 X:42573316-42573338 AGGAGGAGCTCAAAGTGGCCAGG - Intergenic
1190522224 X:51292217-51292239 GAAAGAATCTCAGAGTGTCATGG + Intergenic
1190527653 X:51344266-51344288 ATGAGGATCCCAAAGTGGCCAGG + Intergenic
1190948647 X:55120586-55120608 CAAAGGGTCTCACAGTCTCCTGG - Intronic
1190996380 X:55614471-55614493 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1190996532 X:55615847-55615869 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1191004027 X:55691076-55691098 AAAAGGAAGTCAAATTGTCCCGG + Intergenic
1191719023 X:64214080-64214102 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1191759573 X:64631535-64631557 AGGAGGAGCTCAAAGTGTCCAGG - Intergenic
1191769281 X:64738455-64738477 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1191933131 X:66395789-66395811 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1192027781 X:67473441-67473463 AAGAGGAAGTCAAATTGTCCCGG + Intergenic
1192673038 X:73166768-73166790 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1192951820 X:76025782-76025804 AAAAGGATGTTAAAGCTTCCAGG + Intergenic
1193288151 X:79737849-79737871 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1193356466 X:80524779-80524801 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1193841331 X:86412129-86412151 AGGAGGAGCCCAAAGTGTCCAGG + Intronic
1193904690 X:87227461-87227483 AGGAGGAGCTCAAAGTGTCCCGG - Intergenic
1193905465 X:87238286-87238308 AAGAGGAGCCCAAAGTGTCCAGG + Intergenic
1194087688 X:89549504-89549526 ATAAGTATCTCAAAGTAGCCAGG + Intergenic
1194210506 X:91063985-91064007 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1194233074 X:91347921-91347943 AGGAGGAGCTCAAAGTGGCCAGG - Intergenic
1194261057 X:91696455-91696477 AAAAAGAGCTCAAAGTGCCAAGG - Intergenic
1194457174 X:94119114-94119136 AGCAGGAGCCCAAAGTGTCCAGG - Intergenic
1194513207 X:94820628-94820650 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1195748687 X:108143607-108143629 AAGAGGAGCCCAAAGTGTCCAGG + Intronic
1196372452 X:114994944-114994966 AGGAGGATCCCAAAGTGTCAAGG + Intergenic
1196605333 X:117651230-117651252 AGAAGGAGCCCAAAGTATCCAGG - Intergenic
1197044629 X:121979949-121979971 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1197396098 X:125929315-125929337 AAGAGGAAGTCAAATTGTCCCGG - Intergenic
1197409118 X:126094824-126094846 AAGAGGAGCCCAAAGTGTCCAGG + Intergenic
1197420106 X:126227972-126227994 AGGAGGAGCCCAAAGTGTCCAGG - Intergenic
1197420427 X:126231407-126231429 AAGAGGAAGTCAAATTGTCCCGG - Intergenic
1197477162 X:126939924-126939946 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1198185974 X:134254414-134254436 ACAAGGAGCCCAAAGTGTCCAGG + Intergenic
1198412273 X:136382798-136382820 AGGAGGAACCCAAAGTGTCCAGG + Intronic
1199340790 X:146674984-146675006 GACAGAATCTCAAAGGGTCCAGG + Intergenic
1200440332 Y:3205369-3205391 ATAAGTATCTCAAAGTAGCCAGG + Intergenic
1200579706 Y:4935257-4935279 AAAAAGAGCTCAAAGTGCCAAGG - Intergenic
1200745830 Y:6903234-6903256 AGGAGGAGCCCAAAGTGTCCAGG + Intergenic
1201607147 Y:15799604-15799626 AAAGGGGTCTCAAAGTGACTTGG - Intergenic
1202200410 Y:22341561-22341583 AAGAGGAAGTCAAATTGTCCCGG - Intronic