ID: 985077517

View in Genome Browser
Species Human (GRCh38)
Location 4:186231070-186231092
Sequence TATCCTACCCCCTGGGGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985077517_985077521 -8 Left 985077517 4:186231070-186231092 CCAAATCCCCAGGGGGTAGGATA 0: 1
1: 0
2: 0
3: 12
4: 116
Right 985077521 4:186231085-186231107 GTAGGATAGTGCAGAGAAGATGG 0: 1
1: 0
2: 2
3: 26
4: 292
985077517_985077523 23 Left 985077517 4:186231070-186231092 CCAAATCCCCAGGGGGTAGGATA 0: 1
1: 0
2: 0
3: 12
4: 116
Right 985077523 4:186231116-186231138 AGTGCTTAATAAAATGCACGTGG 0: 1
1: 0
2: 0
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985077517 Original CRISPR TATCCTACCCCCTGGGGATT TGG (reversed) Intronic
901925801 1:12565292-12565314 CATCCTGCCCCTTGGGGGTTTGG + Intergenic
902878411 1:19354827-19354849 CATCCTGCCACCTGGGGAGTGGG - Intronic
906028596 1:42697899-42697921 TATCCTACCACCGTGGGACTGGG - Intronic
906114649 1:43348743-43348765 TCTCCGACCGCCTGGGGATTCGG + Intronic
907493545 1:54826325-54826347 TGTCCTACACCCTGGGGAATGGG - Intronic
915312392 1:155011135-155011157 TTTCCCCCACCCTGGGGATTAGG - Intronic
916334693 1:163657298-163657320 TATCCAAAACCCTGTGGATTAGG - Intergenic
916660000 1:166914716-166914738 TATCCTACCCCCTAGTCATCTGG - Exonic
917587059 1:176437985-176438007 TGTCCTTCCCACTGGGGATTAGG + Intergenic
917725871 1:177826599-177826621 TTTCCTTCCCCCTGGGGCTCTGG + Intergenic
919056720 1:192580438-192580460 TATGCTACCCTTTGGAGATTTGG - Intergenic
922399635 1:225239010-225239032 TGCCCTGCCCCCTGGGAATTTGG + Intronic
924852478 1:247844330-247844352 AATCCTTCCACCTGGGCATTAGG + Intergenic
1064963928 10:20996239-20996261 TGCCCTACCCCCTGGGGAAAAGG - Intronic
1067993937 10:51247621-51247643 TATGCTGGCCCCTGAGGATTTGG - Intronic
1068796638 10:61089493-61089515 TATCCTTTCCCCTGGGGGTTGGG - Intergenic
1071699556 10:87915591-87915613 TATCCCACCCCTGAGGGATTAGG - Intronic
1076037899 10:127216096-127216118 TTCCCTACCTCCTGGGGATCAGG - Intronic
1078720649 11:13880626-13880648 AATCCTACACCCTGGGGAAGGGG - Intergenic
1079025837 11:16946944-16946966 TACCCTTTCACCTGGGGATTAGG - Intronic
1080826642 11:35854134-35854156 TATCCCACTCACTGGGGCTTTGG + Intergenic
1081450853 11:43169645-43169667 TACTCTACCCCCTGGATATTAGG + Intergenic
1082168293 11:48971167-48971189 TACTCTACCCCCTGGATATTAGG + Intergenic
1082168501 11:48972527-48972549 TACTCTACCCCCTGGATATTTGG + Intergenic
1082235151 11:49814782-49814804 TACTCTACCCCCTGGATATTAGG - Intergenic
1082608840 11:55275753-55275775 TACTCTACCCCCTGGATATTAGG - Intergenic
1085181804 11:74542673-74542695 TATCATACCCCATTGGGAATAGG - Intronic
1086701636 11:89905918-89905940 TACTCTACCCCCTGGATATTAGG - Intergenic
1086704532 11:89938607-89938629 TACTCTACCCCCTGGATATTAGG + Intergenic
1089378525 11:118011723-118011745 TTTCCTAACCCCTGAGGTTTGGG - Intergenic
1089816780 11:121183081-121183103 TGTCCTACACCCTGGGGAACAGG - Intronic
1092435809 12:8446131-8446153 TACTCTACCCGCTGGGTATTAGG - Intergenic
1092979788 12:13783218-13783240 TGTCCTGCCCCTTGGTGATTGGG - Intronic
1097535803 12:60869574-60869596 TATCCTCCCTCCGGGGGCTTAGG - Intergenic
1098180442 12:67840847-67840869 TATCTTACACCCTGGGAAATGGG - Intergenic
1098762474 12:74442137-74442159 TATCCTAGCCCCTGAGGATCTGG + Intergenic
1108818012 13:54314550-54314572 TACTCTACCCCCTGGATATTAGG + Intergenic
1111810478 13:93091896-93091918 TCTTCTACCCCCTGGCTATTAGG - Intergenic
1112399951 13:99067810-99067832 TATCCTCCACCCTGGGCAATGGG - Intronic
1112815065 13:103263697-103263719 CACCCTACACCCTGGGGAATGGG - Intergenic
1112971298 13:105266513-105266535 TATCCTTCCTGCTGGGGATCAGG - Intergenic
1114690566 14:24576172-24576194 TCTCCTACCCACTGGGGCTGAGG - Exonic
1116519150 14:45829688-45829710 TCTCCCACCCCCTGGATATTAGG - Intergenic
1117037377 14:51742948-51742970 TACTCTACCCCCTGGATATTAGG - Intergenic
1117037877 14:51745662-51745684 TACTCTACCCGCTGGGTATTAGG + Intergenic
1117041564 14:51773569-51773591 TACTCTACCCCCTGGATATTAGG - Intergenic
1125488231 15:40127154-40127176 TATTCTACCCCCTGAAAATTAGG - Intergenic
1129329774 15:74821063-74821085 GAGCCTTTCCCCTGGGGATTAGG - Exonic
1130909828 15:88263361-88263383 TGTCCTACCACCTGGGCCTTTGG + Intergenic
1146735280 17:35233250-35233272 TATCCTTCCTCGTGGGGATATGG + Intergenic
1148635144 17:49143390-49143412 CATCCTACCACCTATGGATTTGG - Intronic
1151183283 17:72345086-72345108 TATCTTAAGCCATGGGGATTTGG - Intergenic
1156460604 18:37319460-37319482 GATCCTACCCACTAGGGCTTGGG - Intronic
1158835059 18:61322142-61322164 TATCCTTACCTCTGGGGTTTGGG + Intergenic
1161709882 19:5841895-5841917 CCTCTTACCCCCTGGGGACTGGG + Intergenic
1161716091 19:5877047-5877069 CCTCTTACCCCCTGGGGACTGGG + Intronic
1164479295 19:28599038-28599060 CATGCTACCCCCTGGGGGTGGGG - Intergenic
1164745700 19:30611143-30611165 TATTCTACCCCCAGAGGGTTTGG - Intronic
1166099170 19:40560824-40560846 AATCCTGTCCCCTGGTGATTGGG + Intronic
930265037 2:49189744-49189766 TATCCTACCTCCTGGGAAGTGGG + Intergenic
932352284 2:71042267-71042289 TACTCTACCCGCTGGGTATTAGG + Intergenic
933456848 2:82528621-82528643 TACTCTACCCCCTGGATATTAGG - Intergenic
933654811 2:84878875-84878897 TGTCTTACCCCCTGCGGAATTGG - Intronic
937173573 2:119903100-119903122 TGTCCTTCACCCTGGGGAATGGG + Intronic
937478936 2:122239592-122239614 TTTCCTACCACCAGGGGAATCGG - Intergenic
937885134 2:126894448-126894470 TACCCTACCTCCTTGGGCTTTGG - Intergenic
937931023 2:127205330-127205352 AGTCCCACCCCATGGGGATTTGG + Intronic
943674631 2:190705070-190705092 TCTCCTACCCCCTGGGGAGAGGG - Intergenic
943842455 2:192599664-192599686 TACTCTACCCCCTGGATATTAGG + Intergenic
1169533026 20:6505861-6505883 CACCCTACTCCCTGGGAATTTGG - Intergenic
1171009237 20:21499002-21499024 AATTCTACCCCTTGGGGATGAGG - Intergenic
1174161804 20:48556423-48556445 TATCCTGCTCCCAAGGGATTAGG - Intergenic
1177594894 21:23225962-23225984 TATTCCTCCCCCTGAGGATTGGG + Intergenic
1179634359 21:42697813-42697835 AATCTTACCCACTGGGGATGAGG + Intronic
1183116156 22:35694194-35694216 TACTCTACCCCCTGGATATTAGG - Intergenic
1183117045 22:35700216-35700238 TACTCTACCCCCTGGATATTAGG - Intergenic
1184064765 22:42111956-42111978 TATCCTGCCCTCTAGGGGTTTGG + Intergenic
1184491446 22:44811547-44811569 TATCCAACCTCCCGGGGAGTGGG - Intronic
1185314739 22:50174190-50174212 TGTCCTCCCACCTGGGGAGTGGG - Intronic
950651792 3:14411813-14411835 TGTCCTAGGCCCTGGGGATGTGG + Intronic
952006278 3:28845811-28845833 GTCCCTACCCCCTGGGGACTAGG + Intergenic
954197730 3:49006409-49006431 CTTCCTACTCCCTGGGGCTTGGG + Intronic
959323166 3:104904446-104904468 TATCCTAGGCCCTGGGGCCTAGG + Intergenic
963989390 3:151635541-151635563 TATCCATCACCCTGGGGGTTAGG + Intergenic
965085354 3:164088949-164088971 TTACCTGCCCACTGGGGATTTGG + Intergenic
967901080 3:194452901-194452923 TATGCTAGGCTCTGGGGATTCGG - Intronic
969020543 4:4137326-4137348 TACTCTACCCGCTGGGTATTAGG - Intergenic
969733289 4:8970010-8970032 TACTCTACCCGCTGGGTATTAGG + Intergenic
969792880 4:9504086-9504108 TACTCTACCCGCTGGGTATTAGG + Intergenic
969826158 4:9759786-9759808 TACTCTACCCGCTGGGTATTAGG + Intergenic
976341209 4:83947186-83947208 TAGCCTTCCCCATGGGGATCTGG + Intergenic
979738231 4:124116619-124116641 TTTTTTACTCCCTGGGGATTTGG + Intergenic
980286561 4:130785551-130785573 TATCCTCCCTCCCAGGGATTAGG + Intergenic
983961285 4:173757789-173757811 TATCTGTCCCCCTGGGGAATGGG - Intergenic
985077517 4:186231070-186231092 TATCCTACCCCCTGGGGATTTGG - Intronic
985635569 5:1034160-1034182 GATCCTTCCCCCTGTGGAGTTGG + Intronic
985713171 5:1441786-1441808 TATCCTTCCCCGTGGTGGTTCGG + Intronic
985959259 5:3287484-3287506 AATCCTACCTCCTGGGCCTTGGG + Intergenic
987274944 5:16352466-16352488 TCTCCTTTCCCCTGGGGATTAGG - Intergenic
994397102 5:99234131-99234153 TACTCTACCCCCTGGATATTAGG - Intergenic
994807716 5:104473048-104473070 TATCATATACCATGGGGATTAGG - Intergenic
994807721 5:104473084-104473106 TATCATATGCACTGGGGATTAGG - Intergenic
996626856 5:125580453-125580475 TATCCTGGTTCCTGGGGATTGGG - Intergenic
999770854 5:154774441-154774463 TATCCTACCTCGAGGGAATTTGG - Intronic
1006341750 6:33451286-33451308 AATCCAAACCCCTGTGGATTTGG - Intronic
1009365615 6:62855701-62855723 TCTCCTCCCCCCTGTGTATTAGG - Intergenic
1010381474 6:75230711-75230733 TCTCTTACCCGCTGGGGAGTAGG - Intergenic
1012427662 6:99131845-99131867 TATCCCACACCCTGGGTATTGGG + Intergenic
1018812329 6:167307071-167307093 TGTCCTACCCCCTGGCTACTCGG + Intronic
1020307976 7:6849436-6849458 TACTCTACCCTCTGGGTATTAGG - Intergenic
1022787534 7:33653330-33653352 ATTCCTTCCCCCTGGGGATGGGG + Intergenic
1026858205 7:73768828-73768850 TTGCCCACTCCCTGGGGATTCGG - Intergenic
1029079094 7:97958366-97958388 TACTCTACCCGCTGGGTATTAGG - Intergenic
1029699137 7:102235053-102235075 TTTCCCAGCCTCTGGGGATTTGG + Intronic
1030126342 7:106155970-106155992 TATCCCACCCCATGAGGAGTAGG - Intergenic
1037533468 8:19802553-19802575 TAACATACCCTCTGGGGTTTTGG + Intergenic
1039554214 8:38465562-38465584 TATCCTACCCCCAGTGGGTTAGG - Intronic
1041772572 8:61487685-61487707 TATCCTCCCCACTAGGGATGGGG - Intronic
1043550187 8:81362860-81362882 TCTCAAACCCCCTGGGGATAGGG - Intergenic
1044052507 8:87525060-87525082 AATCCTACACCCTGAGGATAAGG - Intronic
1046702676 8:117418759-117418781 TGCCCTTCCCCCTGGGAATTCGG - Intergenic
1050902563 9:10965507-10965529 TACTCTACCCCCTGGATATTAGG + Intergenic
1056864922 9:90220712-90220734 TACTCTACCCGCTGGGTATTAGG + Intergenic
1056918105 9:90762173-90762195 TACTCTACCCGCTGGGTATTAGG - Intergenic
1057747564 9:97764104-97764126 TAAGCTACCCCCTGGGGATGGGG - Intergenic
1058518891 9:105800449-105800471 TATCTTCCCCCCTGGATATTTGG + Intergenic
1059344331 9:113617816-113617838 TATCCTACTCCCAGGGGTTGTGG + Intergenic
1198657298 X:138928575-138928597 TATGCTGCCCTCTGGGGATTGGG - Intronic
1199698721 X:150361745-150361767 TATCCCACCTCCCGGGTATTTGG - Intronic