ID: 985081384

View in Genome Browser
Species Human (GRCh38)
Location 4:186268326-186268348
Sequence ATCAGGGACTTGAGCGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 945
Summary {0: 1, 1: 6, 2: 105, 3: 246, 4: 587}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985081384 Original CRISPR ATCAGGGACTTGAGCGTTCA TGG Intronic
900410195 1:2509150-2509172 ATCAGGGAATTGAGCGGTAGGGG - Intronic
901275743 1:7989772-7989794 AGCAGGGACCTGGGCATTCAAGG + Intergenic
901384360 1:8897557-8897579 CTGAGGGACTTGAGCTTTGAGGG - Intergenic
901464012 1:9409284-9409306 ATAAGGGATTTGAGCATTCGTGG + Intergenic
901821182 1:11830549-11830571 ATCTGGGACTTGAGCATCCCTGG + Intronic
901907593 1:12427680-12427702 ATCAGGGACTTCAGCGTCTGTGG + Intronic
902050353 1:13559450-13559472 ACCAGGGACTTGAGGATCCAAGG + Intergenic
903308608 1:22433590-22433612 ATCAGGGACTTGAGCATCCATGG + Intergenic
903940758 1:26929560-26929582 ATAAGGGACTTGAGCATCCTCGG + Intronic
903966966 1:27096782-27096804 ATAAGGGACTTGAGCTTCCTTGG - Intergenic
903967032 1:27097293-27097315 ATCAGGAACTTGAGCATGAAAGG + Intergenic
904790416 1:33016136-33016158 ATCAGGGACTTGAGCATCTATGG - Intronic
905077460 1:35285715-35285737 ATAAGGGACTTGAGCATTCAAGG + Intronic
905141294 1:35846862-35846884 ATCAGGGACTTGAGCATATGTGG - Intronic
905185171 1:36191022-36191044 ATCAGAGACTTGAGCATCCAAGG - Intergenic
905603498 1:39274580-39274602 ATCTGGGACTTGAGCATTTGTGG + Intronic
905673854 1:39811424-39811446 ATAAGGGACTTGATCATCCATGG - Intergenic
905741842 1:40377897-40377919 ATCAGGGACTTGAGCATCTGTGG - Intronic
906011426 1:42530785-42530807 ATGAGGGACTTGAGCATCCATGG + Intronic
906820516 1:48925250-48925272 ATAAAGGACTTGAGTGTCCATGG - Intronic
907094112 1:51760159-51760181 ATCAGGGACTTGAGTGTCTGTGG + Intronic
907167013 1:52421679-52421701 ATCAGGGACCTGAGCATCCTTGG - Intronic
907499786 1:54870471-54870493 GTAAGGGACTTGAGCATTCATGG - Intronic
907790810 1:57661622-57661644 ATAAGGGACTTCAGCATCCATGG - Intronic
908327649 1:63039227-63039249 ATCAGGGACTTGAGAATTTGTGG + Intergenic
908352317 1:63298518-63298540 ATAAGGGACTTCAGTATTCATGG + Intergenic
908410041 1:63854823-63854845 ATCAGAGACTTGAGCATCCAAGG - Intronic
908812156 1:67993014-67993036 ATAAGGGACTTGAGTATCCATGG - Intergenic
909112004 1:71491294-71491316 ATCAGGGACTTGAGCATCTTTGG + Intronic
910130863 1:83903512-83903534 ATCATGGACTTGAGCATCCATGG - Intronic
910189125 1:84576682-84576704 ATAAGGGACTTGAGCATCCATGG + Intergenic
910386445 1:86688530-86688552 ATAAGGGGTTTGAGCATTCAAGG - Intergenic
910578399 1:88793677-88793699 ATAAAGGACTTGAGCATCCATGG - Intronic
910769793 1:90819339-90819361 ATGAGGAACTTGAGCATCCATGG + Intergenic
910943182 1:92559028-92559050 ATAAGGGACTTGTGCATCCATGG - Intronic
911028012 1:93455508-93455530 ATAAGGGACTTGAGCATCCATGG + Intronic
911139734 1:94486255-94486277 ATCAGGGACTTGAGCATCCATGG + Intronic
911709424 1:101053137-101053159 ATCAGGGACTTGAGCTTCCTTGG - Intergenic
911804151 1:102184473-102184495 ATAAGGGACTTGAGCATCCATGG + Intergenic
912338126 1:108882323-108882345 ATAAGGAACTTGAGCATCCATGG - Intronic
912865170 1:113250150-113250172 ATGAGGGACTTGAACATTCATGG + Intergenic
913050248 1:115111178-115111200 ATAAGGGACTTGAGCATCCGTGG - Intergenic
913193857 1:116436744-116436766 TTGAGGGACTTGAGCATCCAAGG + Intergenic
913312496 1:117515320-117515342 ATCAAGGATTTGAGCATTCAAGG + Intronic
915013730 1:152713876-152713898 ATCAGAGACTTGTGGATTCATGG - Intergenic
916911899 1:169359101-169359123 GTAAGGGACTTGAGCGTCTAAGG - Intronic
917050588 1:170917804-170917826 ATCAGGGGCTTGATGGTTTAGGG + Intergenic
917227831 1:172802910-172802932 CTGATGGACTTGAGCTTTCAGGG - Intergenic
917778278 1:178362258-178362280 ATCAGGGATTTAAGCATCCATGG + Intronic
918031000 1:180810899-180810921 ATAAGGGACTTGAGCATCCACGG - Intronic
918402783 1:184180466-184180488 ATAAGGGACTTGAGCATCCATGG + Intergenic
918490339 1:185074876-185074898 ATAAGGGACTTGAGTATCCATGG + Intronic
918491818 1:185089383-185089405 ATAAGGGACTTGAGCATCCAAGG + Intronic
918666805 1:187161653-187161675 ATAAGGCACTTGAGCATCCATGG + Intergenic
918783955 1:188740155-188740177 ATCAGAGACTTGAGCATCCATGG + Intergenic
918960985 1:191277498-191277520 ATAAGGGACTTGAGCATGCTTGG - Intergenic
919279356 1:195467376-195467398 ATCAGGGACTTGAGCATATATGG - Intergenic
919361059 1:196595512-196595534 ATCAGAGACTTGAGCATTTGTGG - Intronic
920861687 1:209713617-209713639 ACAAGGGACTTGAGCATCCATGG - Intronic
921186046 1:212670409-212670431 GTCAGGGACTTGAGCGTCTTTGG + Intergenic
921582693 1:216913347-216913369 ATCAGGGACTTGAGTATTCATGG + Intronic
922224975 1:223638274-223638296 ATCAGGGACTTGAGCATCTGTGG + Intronic
922328719 1:224555003-224555025 ATCAGGGACTTGAGCATCCGTGG + Intronic
922563469 1:226586163-226586185 CTCAAGGACTTAAGGGTTCAGGG + Intronic
922908881 1:229198894-229198916 AACAGGGACTTGAGCATCCATGG + Intergenic
922998231 1:229983970-229983992 ATCAGGGACTTGAGCTTCCATGG + Intergenic
923162596 1:231329487-231329509 ACCAGGGACTTGAGCGTCTGTGG + Intergenic
923173367 1:231438399-231438421 ATAAGGAACTTGAGCATCCATGG + Intergenic
923633050 1:235667595-235667617 ATCAAGGACTTGAGCATCCATGG - Intronic
923846225 1:237735665-237735687 GTCAGGGATTTGAGCATTCTTGG - Intronic
923998301 1:239521933-239521955 ATAAGGGACATGAGCATCCAAGG + Intronic
924079274 1:240376707-240376729 ATAAGGGACTTTAGCATCCATGG + Intronic
924092095 1:240511767-240511789 AAAAGGGACTTGAGCGTCCGTGG + Intronic
924192533 1:241568927-241568949 AACAGGGACATGAGCATCCATGG - Intronic
924405568 1:243742128-243742150 ATAAGGGACTTGAGCATCCTTGG + Intronic
924583279 1:245340190-245340212 ACCAGGGACTTGAGCATTTGTGG - Intronic
924699638 1:246438561-246438583 AGAAGGGACTTGAGCATCCATGG - Intronic
924820548 1:247485706-247485728 ACAAGGGACTTGAGCATTCGCGG - Intergenic
1062995857 10:1866185-1866207 ATAAGGGACTTGAGCATCCGAGG + Intergenic
1063238437 10:4143436-4143458 AGCAGGGAGGTGAGCTTTCAGGG + Intergenic
1063551610 10:7039236-7039258 ATCAGGGACCTGAGCTCTCAAGG - Intergenic
1063648534 10:7909911-7909933 ATCAGGGACCTGAGCAGTCGTGG - Intronic
1063649605 10:7919603-7919625 ATAAGGGACTTGAGCATTTGAGG - Intronic
1064412627 10:15120532-15120554 ATAAGGGACTTGAGCACCCAAGG + Intronic
1065818664 10:29505916-29505938 ATCAGGGACTTGAGCATCTGTGG - Intronic
1065962042 10:30741766-30741788 ATCAGAGACGTGAGCATTTAAGG + Intergenic
1066178304 10:32934426-32934448 ATCAGGGACTTGAGTATTTGTGG + Intronic
1066255097 10:33670796-33670818 ATCAGGGACTTGAGCATCTGTGG - Intergenic
1066613767 10:37276603-37276625 CTGAGGGACTTGAGCTTTGAGGG + Intronic
1067075505 10:43178233-43178255 ATAAGGGACTTGATCGACCATGG - Intronic
1067364329 10:45610976-45610998 ATAAGAGACTTGAGCATCCATGG - Intergenic
1067935499 10:50608836-50608858 ATGATGGACTTGAGCATCCACGG - Intronic
1067938194 10:50629143-50629165 ATCAGGGACTTGAGCATCTGAGG - Intergenic
1068672643 10:59739351-59739373 ATCAGGGACTTGAGCATTTATGG - Intergenic
1068700771 10:60017432-60017454 ATCAGGGACTTGAGCATCTGTGG + Intergenic
1068721813 10:60254052-60254074 ATAAGGGACTTGAGCATCCATGG - Intronic
1069650815 10:70046799-70046821 ATAAGGGACTTGAGCATCCTTGG - Intergenic
1069836707 10:71313757-71313779 ATGAGGGACATGGGAGTTCAGGG + Intergenic
1070143243 10:73754584-73754606 ATGAGGGACTTGAGCCTTTGTGG - Intronic
1070209800 10:74304988-74305010 ATCAGGGACTTGAGAATCCTTGG - Intronic
1070271025 10:74955057-74955079 ATAAGGGACTTGAGCATCCATGG - Intronic
1070673116 10:78392163-78392185 ACCAGGGACTTGAGCATCCCTGG + Intergenic
1070957853 10:80475967-80475989 ATTAGGGACTTGAGCATCTATGG - Intronic
1071221070 10:83464812-83464834 CTGAGGGACTTGAGCTTTGAGGG - Intergenic
1072087633 10:92096337-92096359 GTAAGGGACTTGAGCATCCATGG + Intronic
1072768605 10:98116989-98117011 ATAAGGGACTGGAGCATCCATGG - Intergenic
1072867361 10:99078345-99078367 ATTAGAGACTTGAGCATCCATGG - Intronic
1072977501 10:100071849-100071871 ATAAGGGACTTGAGCATCCAAGG + Intronic
1072984746 10:100129827-100129849 ATCAGAGAACTGAGGGTTCAGGG - Intergenic
1074091454 10:110262353-110262375 ATCAGGGACTTCAGCATTTGGGG + Intronic
1074131334 10:110580200-110580222 ATAAGGGACTTGAGCATCCTTGG + Intronic
1074464575 10:113669864-113669886 ATAAGGAACTTGAGCATGCATGG - Intergenic
1074841924 10:117361954-117361976 ATCAGGGACTTGAGCATCTGTGG + Intronic
1075059567 10:119246173-119246195 ATCAGGGACTTGAGCATCCATGG - Intronic
1075063098 10:119270517-119270539 ATCAGGGACTTGAGCATCCATGG + Intronic
1075076549 10:119354966-119354988 ATCAGGGACTCGAGCATTCATGG - Intronic
1075214493 10:120520267-120520289 ATCATGGAGCTGAGTGTTCAAGG + Intronic
1075220322 10:120579132-120579154 TGCAGGGACTTGAGGGGTCAGGG - Intronic
1075239622 10:120766112-120766134 ATCAGAGACTTGAGCATCCATGG + Intergenic
1076341542 10:129750689-129750711 ATCAGGAACTTAAGCATCCATGG + Intronic
1077285196 11:1762469-1762491 CCCAGGGACTTGAGAGTACAAGG + Intronic
1077939374 11:6824363-6824385 AGCAGGGACTTGAGCTTCAAAGG + Intergenic
1078241255 11:9532584-9532606 ATCAGGGACTTGAGAATCCATGG + Intergenic
1078306591 11:10194404-10194426 ATAAGGAACTTGAGCATCCATGG + Intronic
1078397853 11:10997495-10997517 ATCAGGGACTTGAGCATCTTTGG - Intergenic
1078558224 11:12348432-12348454 ATAAGGGACTTGAGCACTCATGG + Intronic
1078709849 11:13780469-13780491 ATAAGGGACTTGAGCATCCATGG - Intergenic
1078928752 11:15897159-15897181 ATCAGGGACTTGATCATCCATGG + Intergenic
1079050244 11:17149421-17149443 ATCAGGGATTTGAGCATCCTGGG + Intronic
1079592775 11:22200981-22201003 ATAAGGGACTTGAGCATCCTTGG - Intronic
1079816306 11:25063278-25063300 TTAAGGGACTTGAGCATCCATGG + Intronic
1080422260 11:32121051-32121073 ATCAGGCACTTGAGCGCCCTTGG + Intergenic
1082070486 11:47935760-47935782 TTCAGGGACTTGAGCATCCATGG + Intergenic
1083568000 11:63736754-63736776 ATAAGGGACTTGGGCTTCCATGG + Intronic
1084244698 11:67848933-67848955 ATCAGGTACTTGAGGGAGCATGG + Intergenic
1084362827 11:68680025-68680047 ATAAGGGACTTGAGCATCCACGG - Intergenic
1084754059 11:71223591-71223613 ATCAGGGACTTGAGCATCCATGG + Intronic
1085231815 11:74978543-74978565 ATAAGGGACTTGAGCATCCTTGG - Exonic
1085373723 11:76038530-76038552 ATCAGGGGCTTGAGCTTACTTGG + Intronic
1085910134 11:80814326-80814348 CTCAGAAACTTGAGCGTCCATGG - Intergenic
1086408798 11:86522925-86522947 ATCAGGGATTTGAGCATCCATGG + Intronic
1087778538 11:102278871-102278893 ATCAGGGACTTGAGCATCCTTGG + Intergenic
1088174221 11:107032750-107032772 ATAAGGGACTTGAGCCTCCATGG - Intergenic
1088352297 11:108903665-108903687 ATCAGGGACTTCAGCACCCATGG + Intronic
1088685830 11:112283911-112283933 ATCAGGGACTTGAGCATCTGTGG - Intergenic
1088837979 11:113594769-113594791 ATCAGGGACTTTAGCATCCATGG + Intergenic
1089213932 11:116824108-116824130 ATCAAGGACTTGAACATCCATGG - Intergenic
1089421437 11:118333958-118333980 ATAAGGGACTTGAGCATCCATGG - Intergenic
1090110531 11:123903236-123903258 ATCAGGGACTTGAGCATTCAGGG + Intergenic
1091501806 12:1025037-1025059 ATCAGGGACTTGAGCATCCTGGG + Intronic
1091535949 12:1409630-1409652 ATAAGGGACTTGAGCAACCATGG - Intronic
1091742420 12:2969367-2969389 ATGAGGGACTTGAGCATCCTCGG + Intronic
1091796885 12:3302512-3302534 ATCAGGGACTTGAGCATCAGTGG - Intergenic
1091869879 12:3880588-3880610 ATCAGGGACTTGAGCATCCCAGG + Intergenic
1092449790 12:8591412-8591434 ACCACGGACTTGAGCGCTCGAGG + Intergenic
1092893339 12:12989969-12989991 ATCAGGGACTTGAGCATCCATGG - Intronic
1093557848 12:20498569-20498591 ATCAGGGACTTGAGCATCCCTGG + Intronic
1093785901 12:23191883-23191905 ATCAGGGACTTAAGCATCCCTGG - Intergenic
1093989995 12:25579422-25579444 ATCAGGGACTTTAGCATTTAAGG + Intronic
1094183783 12:27619192-27619214 ATCAGGGACTTGAGCATCTCTGG - Intronic
1094247674 12:28319541-28319563 ATCAGGGACTTGAGCATTTATGG - Intronic
1094290446 12:28842466-28842488 ATCAGAGACCTGAGCTTTCATGG + Intergenic
1094711660 12:32969852-32969874 ATCAGGGCCTCGAGCATCCATGG - Intergenic
1095457801 12:42407648-42407670 ATAAGGGATTTGAGCATCCATGG - Intronic
1095619983 12:44241038-44241060 ACAAGGGACTTGATCATTCATGG - Intronic
1095871092 12:47028996-47029018 ATGAAGGGCTTGAGCATTCATGG + Intergenic
1096126818 12:49125604-49125626 ATAAGGAACTTGAGCATTCATGG - Intergenic
1097311197 12:58121438-58121460 ATCAGGGACTTGAGCACCCGTGG - Intergenic
1098254014 12:68598314-68598336 ATAAGGGACTTGAGCATCCATGG + Intergenic
1098549404 12:71746699-71746721 ATAACAGACTTGAGCATTCATGG + Intergenic
1099052024 12:77791942-77791964 ATCAGAGACTTGAGCATCCATGG + Intergenic
1099638096 12:85242486-85242508 ATAAGGGACATGAGCATCCATGG + Intronic
1100130860 12:91491676-91491698 ATCAGGGACTTGTGGATCCATGG - Intergenic
1100342772 12:93696928-93696950 ATCAGGGACTTGAGCATCCATGG + Intronic
1100345067 12:93721724-93721746 ATAAGGGACTTGAGCATTCATGG + Intronic
1100502906 12:95191666-95191688 ATAAGGGACTTGAGCATCCATGG - Intronic
1100506125 12:95222014-95222036 ATAAGGGACTTGAGCATCCATGG + Intronic
1101366877 12:104080289-104080311 ATCAGGGACTTGAGCATCCATGG - Intronic
1101974631 12:109346301-109346323 ATCAGGCAATTGAGCATCCATGG + Intergenic
1102270799 12:111533319-111533341 ATCAGGGACTTAAGCATCCCTGG - Intronic
1102563322 12:113778396-113778418 ATCAAGGACTTGAGCATTCATGG + Intergenic
1103428543 12:120860900-120860922 ATAAGGGACTGGAGCATCCAAGG - Intronic
1104871701 12:132003402-132003424 ATAAGGGACTTGAGCATCCTTGG + Intronic
1105548635 13:21370812-21370834 ATCAGGGACTTGAGCATCTGTGG + Intergenic
1105565203 13:21538741-21538763 ATCAGGATCTTGAGCATTCTTGG + Intronic
1105709140 13:22989333-22989355 ATGAGAGACTTGAGCATCCATGG - Intergenic
1105793472 13:23827086-23827108 AAAAGGGACTTGAGCATCCAAGG + Intronic
1105934182 13:25083496-25083518 ATAACAGACTTGAGCATTCATGG - Intergenic
1106113046 13:26793646-26793668 CTCAGGGACTTGAGCATCCTTGG - Intergenic
1106167926 13:27265498-27265520 ATCAGGGACTTAAGCATCCCTGG + Intergenic
1106175955 13:27331888-27331910 ATCAGGGACTTGAGCATCCTTGG + Intergenic
1106232817 13:27834441-27834463 AGCAGGGACTTGAGCATCCATGG - Intergenic
1106261409 13:28070164-28070186 ATCAGGTACTTGAGTATCCATGG + Intronic
1106877105 13:34086064-34086086 ATAAGGGACTTGAGCATTCATGG - Intergenic
1106912008 13:34472873-34472895 ATCAGGGACTTGAGTATCCATGG + Intergenic
1107147954 13:37079820-37079842 ACAAGGGACTTGAGCATCCATGG + Intergenic
1107710870 13:43149347-43149369 ATCAGGGACTTGAGCATCCATGG - Intergenic
1108220198 13:48225733-48225755 ATAAGGGACTTGAGCGTCTGTGG - Intergenic
1108273495 13:48785446-48785468 ATCAGGGACTTGAACATTCATGG - Intergenic
1108342145 13:49507840-49507862 ATAAGGGAACTGAGCATTCACGG + Intronic
1108349460 13:49578143-49578165 ATCAGGGACTTGAGCATCTGTGG - Intronic
1108535023 13:51367073-51367095 ACAAGGGACTTGAGCATTCGTGG - Intronic
1108699240 13:52929778-52929800 ATAAGGGACTTGAGCATGCATGG + Intergenic
1108951834 13:56104158-56104180 ATCAGGGACTTGAGCATCCATGG - Intergenic
1109784430 13:67155937-67155959 ATCAGGGAGGTGAACGTTCCAGG - Intronic
1109818262 13:67617079-67617101 ATAAGGGACTTGAACATCCATGG + Intergenic
1110161301 13:72381613-72381635 ATAAGAGACTTGAGCATACATGG - Intergenic
1110206247 13:72917914-72917936 GTAAGGGACTTGAGCACTCATGG + Intronic
1110243303 13:73292768-73292790 ATCAGGGACTTGAGCATCTGTGG - Intergenic
1110272171 13:73603205-73603227 ATAAGGGACTTGAGCATCCATGG - Intergenic
1110317591 13:74129111-74129133 ATAACGGACTTGAGCATCCATGG - Intronic
1110348271 13:74475066-74475088 ATAAGGGACTTGAGCATCCTTGG + Intergenic
1110517808 13:76437196-76437218 ATTAGGGACTTGAACATTCACGG + Intergenic
1110710007 13:78640276-78640298 ATCAGGAACTTGAACATCCATGG - Intronic
1111393889 13:87637313-87637335 ATCAGGGACTTGAGCATCCGAGG + Intergenic
1112090184 13:96075041-96075063 ATCAGGGATTTGAATGTTCATGG - Intergenic
1112145230 13:96692252-96692274 ATTAGGGACTTGGGCATTCATGG - Intronic
1112456000 13:99564564-99564586 ATCAAGGACTTGAGCATCCATGG - Intergenic
1112517593 13:100068292-100068314 ATAAAGGACCTGAGCATTCATGG + Intergenic
1113491461 13:110695437-110695459 ATCAGGGACTCGAGCATCCAAGG + Intronic
1113562156 13:111290464-111290486 ATCAGGGACTGGAGCGTCTGAGG + Intronic
1113862865 13:113501435-113501457 ATCAGAGACTTGAGCATCCGAGG + Intronic
1114078014 14:19173722-19173744 ATAAGGGACTTGAACATTCCAGG - Intergenic
1114135321 14:19842199-19842221 CTCAGGGATTTGAGCATCCATGG + Intergenic
1114510914 14:23259733-23259755 ATCAGGGATTTGATGATTCAAGG - Intronic
1114889999 14:26908098-26908120 ATCAGGGACTTGAGCATTCATGG - Intergenic
1114930671 14:27463806-27463828 ATCAGGGAATTAAGCATTCTTGG - Intergenic
1115282601 14:31680654-31680676 GTAAGAGACTTGAGCCTTCATGG - Intronic
1115433487 14:33347668-33347690 ATCAAGGACTGGAGCATCCAAGG - Intronic
1115633951 14:35272826-35272848 ATAAGGGACTTGAGCATTTGAGG - Intronic
1115729214 14:36250029-36250051 ATAACGGACTTGAGCATCCATGG + Intergenic
1116011058 14:39352600-39352622 ATAAGAGACTTGAGCATCCATGG - Intronic
1116400131 14:44496599-44496621 TTGAGGGACTTGAGCATTCATGG - Intergenic
1116966030 14:51016073-51016095 ATCAGGGACTTGAGCATCTGTGG - Intronic
1117117148 14:52525842-52525864 ATATGGGACTTGAGCATCCATGG - Intronic
1117284341 14:54272213-54272235 ATCAGGGACTTCAACATCCATGG - Intergenic
1117369026 14:55058993-55059015 ATCAGGTACTTGAGCATCCTGGG + Intronic
1117393040 14:55280830-55280852 ATCAGGAACTTGAGCATCCATGG + Intronic
1118650576 14:67888804-67888826 ATGAGGGACTTGAGCATCCGTGG + Intronic
1118686801 14:68299549-68299571 ATAAAGGACTTGAGCATCCATGG + Intronic
1119220945 14:72906941-72906963 TTCAGGTACTTGACCATTCAGGG - Intergenic
1120210161 14:81626312-81626334 ATCAGTGACTTGAGCATCCATGG + Intergenic
1120425660 14:84344402-84344424 ATAAGGGACTTGAGCATCCGTGG - Intergenic
1120476123 14:84989889-84989911 ATCAGGGACTTGAGAATCTATGG + Intergenic
1120629181 14:86867880-86867902 ATAAGTGACTTGAGCATCCATGG + Intergenic
1121022503 14:90589327-90589349 ATCAGGGACTAGAACATCCATGG - Intronic
1121055017 14:90845305-90845327 GTCAGGGACTTGAGCATCCTCGG + Intergenic
1121140414 14:91536790-91536812 ATAAGGGACTTGAGCATCCATGG - Intergenic
1121166973 14:91811792-91811814 ATAAGGGACTTGAGCATCCATGG - Intronic
1121460977 14:94078219-94078241 ATCAGAGACTTGAGCATCCCTGG + Intronic
1122813920 14:104303065-104303087 TTCAGGAAGATGAGCGTTCATGG + Intergenic
1123927961 15:25137054-25137076 ATAAGGGACTTGAACATCCATGG + Intergenic
1123961000 15:25400299-25400321 ATAATGGACTTGAGCATCCATGG - Intronic
1123976743 15:25560916-25560938 ATCAGAGACTTTAGCATCCATGG + Intergenic
1124270702 15:28277888-28277910 ATCAGGGACTTGAGCATCCTAGG - Intronic
1124574061 15:30892224-30892246 GTCAGGGACTTGAACATCCATGG - Intergenic
1124579001 15:30935603-30935625 ATCAGGGACTTGAGCATCCATGG + Intronic
1124892865 15:33748847-33748869 ATCAGGGACTTGAGCGTTCGTGG - Intronic
1124939167 15:34202025-34202047 ATCAGGGATTTGAGCATCCTCGG + Intronic
1125569044 15:40700858-40700880 ATAAGGGACTTGAGCATTGTTGG + Intronic
1125635784 15:41187427-41187449 ATAAGGGACTTGAGCATTATGGG + Intronic
1125650520 15:41313799-41313821 ATCAGAAACTTGAGTGTCCATGG + Intronic
1125695875 15:41636864-41636886 ATCAGGGATTTGAGCATCCATGG + Intronic
1125742539 15:41976320-41976342 ATAAGGGAGTTGAGCATCCATGG + Intergenic
1125845140 15:42845346-42845368 ATCAGAGACTTGAGCATTGGTGG - Intronic
1126139195 15:45423496-45423518 ATCAGGGACTTGAGTATTCGTGG + Intergenic
1126163499 15:45634874-45634896 ACCAGGGCGTTGAGCGCTCACGG - Exonic
1126408786 15:48350478-48350500 ATAAGGTACTTGAGCATTCTAGG + Intergenic
1126637640 15:50794868-50794890 AAAAGGGACTTGAGCATCCAGGG + Intergenic
1127013308 15:54654183-54654205 AACAGTGACTTGAGTGTACAAGG - Intergenic
1127257201 15:57302394-57302416 ATCAAGGACTTGAGCATCCATGG - Intergenic
1127318848 15:57823023-57823045 ATCAGGGACTTGAGCATCCATGG + Intergenic
1127379294 15:58416341-58416363 ATCAGGGACTTGAGCATCAGTGG + Intronic
1127413584 15:58733598-58733620 ATAAGGGACTTGAGCATTCATGG + Intronic
1127720723 15:61696380-61696402 ATGAGGGACTTGGGAATTCATGG - Intergenic
1127964723 15:63915006-63915028 ATAAGGGACTTGAGCATCCATGG - Intronic
1128297294 15:66534331-66534353 ATAAAGGACTTGAGCATCCATGG + Intronic
1128442625 15:67726753-67726775 ATCAGGGACTTTAACGCTAATGG - Intronic
1129002333 15:72345103-72345125 ATAAGGGACTTGAGCATCCTTGG - Intronic
1129195439 15:73962312-73962334 ATCAGGGACTTGAGCATGCCCGG - Intergenic
1129568017 15:76645199-76645221 ATCAGGGACTTGAACATCCCTGG + Intronic
1130099191 15:80879479-80879501 ATCAGCGACTGGAGCATCCATGG + Intronic
1130117937 15:81021801-81021823 ATCAGGGAGTTGAGCATCCAGGG - Intronic
1130393516 15:83480842-83480864 ATCAGAGGCTTGACCATTCAAGG + Intronic
1130697607 15:86146412-86146434 ATCAGGGACTTGAGCATCTGTGG + Intronic
1130884831 15:88084161-88084183 AAAAGGAACTTGAGCGCTCAGGG + Intronic
1131164447 15:90132171-90132193 ATCAGGGACTTGAGCATGCATGG - Intergenic
1131234884 15:90687322-90687344 ATCAGAGACTTGAGCATCCATGG - Intergenic
1131244701 15:90780923-90780945 ATCAGGGACTTGAGCATCCTTGG + Intronic
1131317293 15:91350987-91351009 ATCAGGGACTTGAGCATCCATGG - Intergenic
1131465220 15:92649325-92649347 ATCAGGGAATTGAGTAGTCAAGG + Intronic
1131588277 15:93719651-93719673 ATCAGGGACTTGAGCATCTGAGG + Intergenic
1132257835 15:100392955-100392977 ATCAGGGACTTGAGCATCTGGGG - Intergenic
1132392450 15:101449131-101449153 ATCAGGGACTTGAGCATCTGTGG - Intronic
1133418801 16:5627849-5627871 ATAAGGGGGTTGAGCATTCATGG + Intergenic
1133491095 16:6268910-6268932 ATCAGGAACTTGAACATCCATGG - Intronic
1133929279 16:10218919-10218941 ATCTGGGAAGTGTGCGTTCATGG - Intergenic
1134746354 16:16591984-16592006 ATCAGGGACTTGAGCTTCTGTGG - Intergenic
1134999126 16:18761716-18761738 ATCAGGGACTTGAGCTTCTATGG + Intergenic
1135238507 16:20781525-20781547 ATAAGGGACTTAAGCATTCCTGG + Intronic
1135963504 16:27016948-27016970 ATAAGGAACTTGAGCATCCATGG - Intergenic
1136085112 16:27879304-27879326 ATCAGGGACTTGAGCATCCTTGG - Intronic
1138355176 16:56372060-56372082 ATCAGAGACTTGAGCATTCATGG + Intronic
1138787755 16:59866804-59866826 ATATGAGACTTGAGCATTCATGG - Intergenic
1138871090 16:60887486-60887508 ATAAGGGACTTGAGCATTCATGG + Intergenic
1138999812 16:62495994-62496016 ATAAGGGACTTGAGCATTCATGG - Intergenic
1139072864 16:63404134-63404156 ATCAGGGACTTGAGGTTTGCTGG + Intergenic
1139231197 16:65284120-65284142 ATCAGAGTCTTGAGAGTTCCTGG + Intergenic
1139626453 16:68193235-68193257 ATAAGGGACTTGCGCATTCATGG + Intronic
1139944392 16:70629476-70629498 ATAAGGGACCTGAGCGTCCATGG - Intronic
1140026440 16:71294741-71294763 ATAAAGGACTTGAGCATCCATGG + Intergenic
1140161075 16:72495136-72495158 ATAAGGGACTTGAGCATCCATGG - Intergenic
1140392991 16:74604399-74604421 ATAAGGTACTTGAGCGTCCTTGG + Intronic
1140534272 16:75694889-75694911 ATCAGGAACTTGAGCATCCTTGG + Intronic
1140563107 16:76007595-76007617 ATAAGGGACTTGAGCGTCCATGG + Intergenic
1141207527 16:81944792-81944814 ATCAGGGACTTGAGCCTCCAAGG + Intronic
1141349952 16:83285686-83285708 ATAAGAGACTTGAGCATTCCAGG + Intronic
1141706308 16:85667043-85667065 ATCAGGGACTTGAACATCCCTGG + Intronic
1142357357 16:89608070-89608092 ATCAGGGACTTGAGCATCCATGG - Intergenic
1143203472 17:5127709-5127731 GTCAGCGACTTGAGCATCCATGG - Intronic
1143693771 17:8594700-8594722 ATAAGGGACTTGAGTATCCATGG - Intronic
1143811245 17:9473453-9473475 ATATGGGACTTGAGCATCCATGG - Intronic
1144265495 17:13564440-13564462 ATAAGGAACTTGAGCATCCATGG - Intronic
1144297824 17:13895856-13895878 ATAAGGGACTTGAGCGTCCCTGG - Intergenic
1144592806 17:16539002-16539024 ATCAGCTACTTGAGCATCCAAGG + Intergenic
1145104025 17:20099924-20099946 ATCAGGGACTTGAGCATCCATGG - Intronic
1145182584 17:20766312-20766334 ATTAGGGACCTGAGCATCCATGG - Intergenic
1145213106 17:21030102-21030124 ATCAGGGACTTGAGTATCCATGG - Intronic
1145357297 17:22171232-22171254 ATTAGGGACTTAAGCATCCATGG - Intergenic
1145759247 17:27416564-27416586 ATCAGAGACTTGAGCATCCATGG - Intergenic
1145799746 17:27675471-27675493 ATCAGAGACTTGAGCATCCATGG + Intergenic
1145823043 17:27855202-27855224 ATAAGGGACTTGAGCATCCTAGG + Intronic
1146845110 17:36177668-36177690 ATCAGAGACTTGAGCATCCATGG + Intronic
1146873331 17:36389517-36389539 ATCAGAGACTTGAGCATCCATGG + Intronic
1146880685 17:36440599-36440621 ATCAGAGACTTGAGCATCCATGG + Intergenic
1147066059 17:37923356-37923378 ATCAGAGACTTGAGCATCCATGG - Intergenic
1147898954 17:43771113-43771135 ATCAGGGACTTGAGCATCTGTGG - Intronic
1148919828 17:51020776-51020798 ATAAGGGACCTGAGCATCCATGG - Intronic
1149398137 17:56265676-56265698 ATAAGGGATTTGAGCATCCATGG - Intronic
1149487806 17:57057078-57057100 ATCAGGGACTTGAGCATCTGTGG + Intergenic
1149955659 17:61046451-61046473 ATCAGGGACTTGAGCATCTGTGG - Intronic
1150029581 17:61718825-61718847 ATCAAGTACTTGAGCATCCATGG - Intronic
1150117956 17:62571223-62571245 ATCAGGGACTTGAGCATCCATGG - Intronic
1150258712 17:63771355-63771377 ATAAGGGACTTGAGTATCCATGG + Intronic
1150534896 17:66026663-66026685 AAAAGGGACTTGAGCATCCATGG - Intronic
1151781426 17:76248780-76248802 ATCAGGGACTTGAGCATCCAAGG - Intergenic
1151791710 17:76309761-76309783 ATCAGGGACTTGCACATCCATGG + Exonic
1153414393 18:4830277-4830299 AAGAGGGACTTGAGCATCCATGG - Intergenic
1154081939 18:11265792-11265814 ATCAGGAACTTGAGCATACTAGG - Intergenic
1154102956 18:11492992-11493014 ATCAGAGACTTGAGCATTCATGG - Intergenic
1154115715 18:11611577-11611599 ATCAGGGACTTGAGCATCCATGG + Intergenic
1154120159 18:11645796-11645818 ATCAGGGACTTGAGCATCCATGG + Intergenic
1154200976 18:12300577-12300599 ATAAGGGACTTGAGCATCCTTGG + Intergenic
1154373398 18:13787078-13787100 ATCAGGCACTTGAGCATCCATGG + Intergenic
1155103888 18:22641490-22641512 ATAGGGGGCTTGAGCATTCAGGG + Intergenic
1155134057 18:22970009-22970031 ATAAGGTACTTGAGCATCCAAGG - Intronic
1155304770 18:24468124-24468146 ATCAGGGACTTCAGCTTTCTTGG - Intronic
1155458891 18:26054007-26054029 GTCAGGGACATGAGCATTTACGG - Intronic
1155487588 18:26363051-26363073 ATCAGGGACTTGAGCGTCTTTGG + Intronic
1155690115 18:28610118-28610140 ATAAGGGACGTGAGCATCCATGG + Intergenic
1155698249 18:28710508-28710530 GTCAGGGACTTGAGCATCCATGG + Intergenic
1156228044 18:35128632-35128654 ATCAGGGACTTCAGCATCCATGG + Intronic
1156235020 18:35194793-35194815 ATAAGGGACTTGAGCATCCTTGG - Intergenic
1156265502 18:35484707-35484729 ATCAGGGACTTGAGGTTCCATGG + Intronic
1157302181 18:46487031-46487053 ATCAGGAACTTGAATATTCAGGG + Intronic
1158383960 18:56967761-56967783 ATCAGGGACTTGAGCATCTATGG - Intronic
1158772410 18:60535420-60535442 ATAAGGGACTTGAGCATCCACGG - Intergenic
1158891801 18:61879396-61879418 ATCAGGGACTTGAGCATGCATGG + Intronic
1158970418 18:62661376-62661398 ATCAGGAACTTGAACATCCATGG + Intergenic
1158989720 18:62856142-62856164 GTCAGGGACTTGAGCATCCGTGG + Intronic
1159435661 18:68413756-68413778 TTAAGGGACTTGAGCATCCATGG + Intergenic
1160287271 18:77555667-77555689 ATCAGATACTTGAGCATCCATGG + Intergenic
1160429821 18:78803789-78803811 ATCAGGGACTTGAGCATCCGAGG + Intergenic
1161067709 19:2246808-2246830 ATCAGGGACTTGGGCGTGGGGGG + Intronic
1162402643 19:10455061-10455083 ATCAGGAACATGAGGGTTCCTGG - Intronic
1162896394 19:13766945-13766967 ATCAGAGACTTGAGCATCCATGG - Intronic
1165195314 19:34097943-34097965 ATAAAGGACTTGAGCATCCATGG - Intergenic
1166266268 19:41686480-41686502 ATCTGGGACTTGTGCTTCCAGGG + Intronic
1167417839 19:49386545-49386567 ATCAGGGGCTTGAGGGCACATGG + Intergenic
1168255679 19:55163607-55163629 ATAAGGGACTTGAGCATCCTTGG + Intronic
925379438 2:3415011-3415033 ACCAAGGACTTGAGCAGTCATGG + Intronic
926655724 2:15403614-15403636 ATCAGGGACTTGAGCATCCATGG + Intronic
926665958 2:15523525-15523547 ATCAGGGACTTGAGCATTTGTGG + Intronic
927259784 2:21076306-21076328 ATCAGGGAACTGAGGTTTCAGGG - Intergenic
927522824 2:23710846-23710868 ATCAGGGACTTGAGCATCCAGGG + Intergenic
927732554 2:25487473-25487495 TTCAGGGACTTGAGCATCCTTGG + Intronic
928604466 2:32932659-32932681 ATCAGCGACTTGAGCATCCATGG - Intergenic
928646203 2:33355338-33355360 ATCAGGGACTTGAGCATCTGTGG - Intronic
928731964 2:34241929-34241951 ATAAGGAACTTGAGCATTCATGG + Intergenic
928835801 2:35543209-35543231 ATAAGGGACTTGAGCGTCTATGG + Intergenic
928934580 2:36662050-36662072 ATGAGGGACTTGAGCATCCTCGG - Intergenic
929182956 2:39063387-39063409 ATAAGGGACTTAAGCATCCATGG + Intronic
929210441 2:39351099-39351121 ATAAGGGACTTGAGCATTCATGG + Intronic
929221998 2:39474333-39474355 ATCAAGGACTTGAGCATCCTTGG - Intergenic
929478683 2:42280622-42280644 ATCAGGAAATTGAGCATCCATGG + Intronic
930004595 2:46886286-46886308 ATCAGGGACTTGAGCATCCATGG + Intergenic
930351105 2:50255536-50255558 ATTGGGGACCTGAGTGTTCAAGG - Intronic
930705905 2:54504660-54504682 ATAAGGGACCTGAGCGTCCATGG + Intronic
930717621 2:54607696-54607718 ATAAGCGACTTGAGCATTTATGG + Intronic
930824803 2:55685779-55685801 ATCAAGGATTTGAGCATCCATGG - Intronic
931306093 2:61030014-61030036 ATTAAGGACTTGAGCATTCATGG + Intronic
931748295 2:65309576-65309598 ATCAGGGACTTGAGCATCTGTGG + Intergenic
931964021 2:67513716-67513738 ATAAGGGATTTGAGCATCCATGG + Intergenic
932035407 2:68241146-68241168 ATCAGGGACTTGAGCATCTGTGG - Intronic
932118053 2:69071053-69071075 TTCAGGGACTTCAGCTTTAAGGG + Intronic
932465399 2:71920372-71920394 ATCAGGGACTTGAGCATCCATGG + Intergenic
933037544 2:77419385-77419407 ATAAGGGACTTGAACATCCATGG - Intronic
933578503 2:84098188-84098210 GTAAGGGACTTGAGCATCCATGG + Intergenic
933621385 2:84546239-84546261 ATAAGGGACTTGAGCATCCGTGG - Intronic
933827797 2:86179277-86179299 ATCTGAGACTTGAGCATCCATGG + Intronic
933872811 2:86586018-86586040 ATCAGAGACTTGAGCATCCGTGG - Intronic
933975541 2:87506457-87506479 ATCAGAGACTTGAGCATCCTTGG - Intergenic
934018050 2:87910831-87910853 ATAAGGGACTTGAGCATTCCTGG + Intergenic
934724080 2:96603880-96603902 ATAAGGGACTTGAGCATCCATGG + Intronic
934932711 2:98441189-98441211 ATAAGGGACATGAGCATCCATGG - Intergenic
935026494 2:99282085-99282107 ATCAGGGACTTGAGCATCCGTGG - Intronic
935262439 2:101366982-101367004 ATCAGGGACTTGAGCATCCACGG + Intronic
935599735 2:104911029-104911051 ATCAGGGACTTGAGTATTCATGG + Intergenic
935819382 2:106878743-106878765 ATCAGGGACTTGAGCATCCATGG + Intronic
935897778 2:107756248-107756270 ATCAGGCACTTGAGCATCCTTGG + Intergenic
935959626 2:108411918-108411940 ATAATGAACTTGAGCATTCATGG + Intergenic
936318284 2:111444356-111444378 ATCAGAGACTTGAGCATCCTTGG + Intergenic
936404770 2:112193121-112193143 ATCAGGGACTTGAGCATCCATGG - Intergenic
936953274 2:117999648-117999670 ATCAGGGACTTGAGCATCTGTGG - Intronic
937049626 2:118877793-118877815 ATAAGGGACTTGAGCATTCATGG + Intergenic
937110274 2:119361629-119361651 ATAAGGGACTTGAGCATCCATGG + Intronic
937918026 2:127108557-127108579 ATGAGGGACTTGAGCATCCCTGG - Intergenic
938638164 2:133251247-133251269 ATCGGGGACTTGAGCATCCATGG + Intronic
939296176 2:140267378-140267400 ATCTGGGACTTGAGCATCTAAGG - Intronic
939313509 2:140516436-140516458 ATAAGGGACTTGAGCATCCATGG + Intronic
939808656 2:146805797-146805819 ATCAAGGACTTGAGCATCCTTGG - Intergenic
939931147 2:148235028-148235050 ATAAGGGACTTGAACATTCCTGG - Intronic
939945774 2:148408982-148409004 GTCAGGGACTTGAGCAGCCATGG + Intronic
940355419 2:152736895-152736917 ATAAGGGACTTGAACATTCATGG + Intronic
940782729 2:157950318-157950340 ATCAGGGACTTGAGCTTCCATGG + Intronic
941246618 2:163106131-163106153 ATAAGGGACTTGAGCATCTATGG + Intergenic
941391394 2:164919602-164919624 ATCAGGGACTTGAGCATCCATGG - Intronic
941394410 2:164956287-164956309 ATCAAGGACCTGAGCATTCCTGG - Intergenic
941447741 2:165623575-165623597 ATCAGGAACTTGAGCATTCATGG + Intronic
941514719 2:166459018-166459040 ATAAGGGACTTGAGAATTCATGG + Intronic
941982208 2:171470965-171470987 ATAAGGTACTTGAGCATCCATGG + Intronic
942016010 2:171816403-171816425 ATAAGGGACATGAGCATCCATGG - Intronic
942383444 2:175417801-175417823 ATCAGGGACTTGAACATCCACGG - Intergenic
943282012 2:185946605-185946627 ATGAGGAACTTGAGCATCCATGG + Intergenic
943694088 2:190904767-190904789 ATAAGGGACTTGAGTGTCCATGG + Intronic
944214922 2:197245410-197245432 GTCAGGGACTTGAGCATCCCTGG + Intronic
944215063 2:197246546-197246568 ATCAGGGACCTGGGAATTCAAGG - Intronic
944929257 2:204500032-204500054 ATAAGGGACTTGGGCATCCATGG + Intergenic
945092918 2:206192842-206192864 ATCAGGGACTTGAGCATCCTTGG - Intronic
945637876 2:212380400-212380422 ACCAGGGACTTGAGTATCCATGG + Intronic
945846403 2:214950226-214950248 ATCAGGGACTTGAGCATCTGTGG + Intronic
946603759 2:221379315-221379337 ATAAGAGACTTGATCATTCATGG - Intergenic
946743379 2:222822126-222822148 ATAAGCGACTTGAGCATTCATGG + Intergenic
947149490 2:227100601-227100623 ATCAGGGACTTGAGCATCTGAGG + Intronic
947152123 2:227126241-227126263 ATCAGGGACGTGAGTATCCATGG + Intronic
947453174 2:230227035-230227057 ATCAGGGACTTGAGCATCCATGG + Intronic
947778378 2:232733680-232733702 ATTAGGGACTTGAGCATCCAAGG - Intronic
948157208 2:235793038-235793060 ACCAGGGACGTCAGGGTTCATGG + Intronic
948417753 2:237826892-237826914 ATAAGGGACTTGAGCATCCTTGG + Intronic
948667913 2:239547723-239547745 ATCAGGGACTTGAGCATCCCAGG + Intergenic
1169008934 20:2233681-2233703 ACAAGGGACTTGAGCATCCATGG + Intergenic
1169122598 20:3106369-3106391 ATCAGGGATTTTAGACTTCAGGG + Intergenic
1169348898 20:4852231-4852253 ATCAGGGACTTGAGTAGTCTCGG + Intergenic
1169600877 20:7259333-7259355 AAAAGGGACTTGAGCATTCATGG - Intergenic
1169937589 20:10901089-10901111 ATAAGGGACTTGAGCATCCATGG - Intergenic
1169982138 20:11396531-11396553 ATCAGGAACTTGAGTGTTCATGG + Intergenic
1170684447 20:18556326-18556348 ATTAGGGACTTGAGCATTTGTGG + Intronic
1171198790 20:23224576-23224598 ACAAGGGACTTGAGCATCCATGG - Intergenic
1171478492 20:25433376-25433398 ATAAGGGACTTGAGCATCCATGG - Intronic
1172497396 20:35397731-35397753 ATCAAGGACTTGAGCATCCACGG + Intronic
1174033046 20:47646087-47646109 ATAAGGGACTTGAGCATCCATGG - Intronic
1174109084 20:48185405-48185427 ATAAGGGACTTGAGCGTTTGTGG - Intergenic
1174109489 20:48188334-48188356 ATCAGGCACTTGAACATCCAAGG - Intergenic
1174124522 20:48293586-48293608 ATCAGAGATTTGAGCACTCATGG + Intergenic
1174732526 20:52931561-52931583 ATCAGGGACTTGAGTGTTTATGG - Intergenic
1174802105 20:53573057-53573079 ATTAGGGACCTGAGCATCCATGG - Intronic
1175088528 20:56482232-56482254 ATCAGAGACCTGAGCATCCATGG - Intronic
1175249346 20:57599475-57599497 ATCAGGGACTTGAGTATCCATGG - Intergenic
1175738258 20:61402194-61402216 ATCAAGGACTTGAGCATCCTTGG - Intronic
1176006291 20:62865055-62865077 ATAAGGGACTTGAACATTCGTGG + Intergenic
1176176860 20:63731964-63731986 ATAAGGGACTTGAGCATCCTTGG + Intronic
1176374202 21:6079163-6079185 ATCAGGCCCTTGAGCCTTCTAGG - Intergenic
1176665646 21:9685140-9685162 ATCAGGGACTTGAGCGTCTAGGG + Intergenic
1177162602 21:17564178-17564200 ATCAGGGACTTGAGCATCCTTGG - Intronic
1177258985 21:18703882-18703904 ATAAGGGACTTGAGCATCCATGG - Intergenic
1177275408 21:18906627-18906649 ATAAGGGACTTGAGCACCCACGG + Intergenic
1177431343 21:20996203-20996225 ATAAGGGACTTGAGCATCCAAGG - Intergenic
1177453213 21:21299867-21299889 TAAAGGGACTTGAGCATTCATGG - Intronic
1178569150 21:33718549-33718571 ATCAGGGACTTGAGGATCCACGG + Intronic
1178696678 21:34798792-34798814 ATGAGGGACTTGAGCATCCATGG + Intronic
1178893474 21:36540201-36540223 ATCAGGGACTTGAACAGCCAAGG - Intronic
1179584950 21:42368518-42368540 ACCAGGGACTTGAGCATTTGTGG - Intergenic
1179749274 21:43459082-43459104 ATCAGGCCCTTGAGCCTTCTAGG + Intergenic
1180004253 21:45012782-45012804 ATCAGGGATTTGTGCCTGCAGGG + Intergenic
1180174949 21:46082897-46082919 ATCGGGGCCTTGAGCATTCGTGG + Intergenic
1181835241 22:25600672-25600694 ATAAGGGACTTGAGCATCCTAGG + Intronic
1181999315 22:26907241-26907263 ATCAGTGACTTGAGGATTCGTGG - Intergenic
1183135081 22:35879460-35879482 ATCAGGGACTTGAGCATCTGCGG + Intronic
1183142812 22:35959848-35959870 ATCAGGGACTTGAGCATCTGTGG - Intronic
1184393144 22:44217291-44217313 ATCAAGGACTTGAGCATTTGTGG + Intronic
1184524732 22:45015127-45015149 ATCAGGGACTTGAGCATCCATGG - Intergenic
949126729 3:454072-454094 ATCAGGGACTTGAGCATCTGTGG + Intergenic
949288523 3:2435269-2435291 ATAAGGGACTTGAGCATCCATGG - Intronic
949654586 3:6202655-6202677 ATCAGGGACTTGAGCATCTGTGG - Intergenic
949698744 3:6730637-6730659 ATCAGGGACTTGAGCATCCTTGG + Intergenic
950006320 3:9693764-9693786 GTAAGGGACTTGAGCATCCAAGG + Intronic
950216755 3:11165571-11165593 TTCAGGGATTTGAACATTCAAGG + Intronic
951239848 3:20274982-20275004 GTGATGGACTTGAGCTTTCAGGG - Intergenic
951393942 3:22141553-22141575 ATCATGGACTTCAGCCTTAAGGG + Intronic
951925493 3:27904987-27905009 ATCAGGAAATTGAGCATCCATGG + Intergenic
951992723 3:28693743-28693765 ATAAAGGACTTGAGCATTCTTGG - Intergenic
952266997 3:31796456-31796478 GTAAGGGACTTGAGCATCCATGG + Intronic
952836072 3:37603429-37603451 ATCAAGGACTTGTGTGTTCTTGG + Intronic
953154138 3:40353600-40353622 ATAAGGGACTTGAGCATCCATGG + Intergenic
953340727 3:42132126-42132148 ATCAGGGACTTGAGCATCCATGG - Intronic
954005429 3:47586840-47586862 ATAAGTGACTTGAGAGTTCCCGG - Exonic
954078738 3:48200111-48200133 ATGAGGGTGTTGAGCTTTCATGG - Intergenic
954477719 3:50764484-50764506 ATCAGGGACTTGAGCATCCATGG + Intronic
954904386 3:54047444-54047466 ATCAGGGAGTTGAGCACCCACGG - Intergenic
955473471 3:59311880-59311902 ATCCGGGACTTGAGTATGCATGG - Intergenic
955476433 3:59341059-59341081 ATCAGAGACTTGAGCATTCATGG + Intergenic
955574172 3:60341101-60341123 ATGCGGGACTTGAGTATTCACGG + Intronic
955676868 3:61457962-61457984 ATAAGGGACTTGAGCATCCATGG - Intergenic
955727575 3:61949430-61949452 ATCAGGGTCTTGAGCATTGGTGG + Intronic
955749473 3:62173057-62173079 ATAAGGGACTTGAGCATCCAAGG - Intronic
955808643 3:62762728-62762750 ATCAGGGACTTGAGCGTCTGAGG + Intronic
956775859 3:72564964-72564986 ATCAGGAACCTGAGCATCCATGG - Intergenic
956776034 3:72566356-72566378 ATCAGGAACTTGAGCATCCATGG + Intergenic
956871306 3:73420832-73420854 ATCAGGAACTTGAGAATTCATGG - Intronic
956899643 3:73702001-73702023 ATCAGGGACTTGACCATCCATGG - Intergenic
956947253 3:74236575-74236597 ATCAGGGACTGGAGCATCAATGG + Intergenic
956991630 3:74773031-74773053 ATCAGAGACTTGAGCATCCATGG - Intergenic
957212760 3:77281597-77281619 ATCAGAGACTTGAGCATCCATGG - Intronic
957343814 3:78936708-78936730 ATAAGGAACTTGAGCATTCATGG + Intronic
958123575 3:89326201-89326223 ACAAGGGACTTGAGCATCCATGG - Intronic
958194375 3:90223965-90223987 ATAAGGGACTTGAGCGTCTGTGG - Intergenic
958578454 3:95984783-95984805 ATCAGGAACTTCAGCCTCCATGG + Intergenic
959152825 3:102628512-102628534 ACCAGGGACTTGAGCATCCTTGG + Intergenic
959172422 3:102859510-102859532 ATAAGGGACTTGAGTTTTCTTGG - Intergenic
959287857 3:104439885-104439907 ATGAGGGACTTGAGCATCCTAGG - Intergenic
960595943 3:119408154-119408176 ATCAGGGACTTGAGCACACATGG + Intronic
960797547 3:121503671-121503693 ATCAGAGACTTGAGCATCCATGG - Intronic
960883851 3:122374391-122374413 ATCAGGGACTTGAGCATCCTTGG - Intronic
960905582 3:122597822-122597844 ATAAGGGACTTGAGGATCCATGG - Intronic
960963445 3:123088670-123088692 ATAAAGGACTTGAGCATCCATGG - Intronic
961263682 3:125622931-125622953 ATCAGCGACTTGAGCAATCATGG - Intergenic
961409586 3:126708973-126708995 ATTAGGGACTTGAGCATCCAAGG - Intronic
961501813 3:127341526-127341548 ATCAGGGACTTGAGCATCCACGG - Intergenic
962789107 3:138794806-138794828 ATCAGGAACTTGAGCATTTCTGG - Intronic
962917877 3:139922969-139922991 ATAAGGGACTTGAGCATCCATGG - Intergenic
963301108 3:143598052-143598074 ACCAGGGACTGGAGAGCTCAGGG - Intronic
963750790 3:149177466-149177488 ATAAGGGACTTGAGCATCCATGG - Intronic
963775938 3:149440210-149440232 ATCAGGGACTTGAGCATCTGTGG + Intergenic
964269045 3:154934988-154935010 ATAAGGGACTTGAGCATTCATGG + Intergenic
964437322 3:156667943-156667965 ATGGGGGACTTGAGCATCCACGG - Intergenic
964536913 3:157732182-157732204 ACCATGGACATGAGGGTTCAAGG + Intergenic
965062263 3:163799510-163799532 ATCAGAGAATTGAGTGTACAGGG - Intergenic
965156551 3:165066256-165066278 ATAAGGAACTTGAGCATCCATGG + Intronic
965789341 3:172371137-172371159 ATAAGGGACTGGAGCTTCCATGG - Intronic
966060331 3:175746895-175746917 ATGAGGAACTTGAACATTCATGG - Intronic
966545851 3:181147149-181147171 TTAAGGGACTTGAGCATCCATGG + Intergenic
966744042 3:183258660-183258682 ATAAGGGACTTGAGCATGCATGG - Intronic
966898406 3:184462958-184462980 ATCAGGGACTTGAGCATCCATGG + Intronic
967476793 3:189930810-189930832 ATAAGGAACTTGAGCATCCATGG - Intergenic
968053359 3:195672098-195672120 ATTAGGGACTTGAGCATCCACGG + Intergenic
968102453 3:195976264-195976286 ATTAGGGACTTGAGCATCCACGG - Intergenic
968558451 4:1262504-1262526 ATCACGGACTTGAGCATCCGGGG - Intergenic
969831435 4:9800830-9800852 ATCAGGGACTTGAGCATTTGTGG + Intronic
970430546 4:15985263-15985285 ATAAGGGACTTGAGCACCCAAGG + Intronic
970965238 4:21920696-21920718 ATCAGGGACTTGAGCATCCATGG + Intronic
971529559 4:27668928-27668950 ATAAGATACTTGAGCTTTCATGG - Intergenic
972813200 4:42613392-42613414 TTAAGGGACTTGAGCATCCATGG - Intronic
973550830 4:52034562-52034584 ATAAGGGACTTGAGCATCAATGG + Intronic
973998603 4:56486007-56486029 ATAAGGGACTTGAGCATCCTTGG + Intronic
974257080 4:59471675-59471697 ATAAGGGACTTGAGCATCCATGG + Intergenic
974372188 4:61031872-61031894 ATAAGGGACTTCAGCATCCATGG - Intergenic
974389426 4:61246241-61246263 ATAAGGGACTTGGGCTTTCAAGG - Intronic
974859753 4:67505489-67505511 ATAAGGGACTTGAGCATCCTTGG - Intronic
974932749 4:68377927-68377949 ATAAGGGAATTGAGCATTCCTGG - Intergenic
975641654 4:76506453-76506475 ATAAGGGACTTGAGCATCCATGG + Intronic
975840692 4:78470727-78470749 ATAAAGGACTTGAGCATCCATGG + Intronic
976045434 4:80941022-80941044 ATCAAGGACTTGGGTATTCATGG - Intronic
976111340 4:81677160-81677182 ATAATGGACTTGAGCATCCATGG - Intronic
976403051 4:84629563-84629585 ATAAGGGACTTGAGCATCCATGG + Intronic
976622939 4:87147514-87147536 ATCAGGGACTTCAGCATCCTTGG - Intergenic
977324855 4:95562374-95562396 ATCAGGGACTTGAGCATCTGTGG - Intergenic
977577699 4:98692264-98692286 GTTAGGGTCTTGAGAGTTCAGGG + Intergenic
978029076 4:103916050-103916072 ATAAGGGAATTGAGCATGCAAGG + Intergenic
978361368 4:107933672-107933694 ATCAGGGACTTGAGCATCCTAGG - Intronic
978471771 4:109076138-109076160 ATCAGAAACTTGAGCATCCATGG + Intronic
978555408 4:109974162-109974184 ATCAGGGAATTGAGCATCCTTGG + Intronic
979194707 4:117906442-117906464 ATAAAGGACTTGAGCATCCATGG - Intergenic
979651322 4:123135754-123135776 ATAAAGGACTTGAGCATCCATGG + Intronic
979915236 4:126423602-126423624 ATCAGGGACTTGAGCATTCATGG - Intergenic
980312637 4:131153471-131153493 ATAAGGGACTGGAGCATCCATGG + Intergenic
980947183 4:139332960-139332982 ATCAAGGACTTGAGCATCCCTGG - Intronic
981025414 4:140072738-140072760 ATCAGGGACTTTAGCATCCCTGG + Intronic
981887203 4:149690650-149690672 ATCAGGAACTTGGGCATTCTCGG + Intergenic
982214238 4:153066502-153066524 ATCAGGGACTTCAGCATTCATGG - Intergenic
983090805 4:163499580-163499602 ATAAGGGACCTGAGCATCCATGG - Intronic
983203739 4:164889964-164889986 ATAAGGGACTTCAGCATCCATGG + Intronic
983335143 4:166382103-166382125 ATAAGAGACTTGAGCATTCCTGG + Intergenic
983397401 4:167217516-167217538 ATAAGGGACTTGAGGATCCATGG + Intronic
983499818 4:168486244-168486266 ATAAGGGACTTGAGTATCCATGG - Intronic
983534774 4:168845600-168845622 ATCAGGGACTTGAGCATGTGTGG + Intronic
984002917 4:174272269-174272291 ACAAGGGACTTGAGCATTCATGG - Intronic
984225351 4:177028223-177028245 ATAAGGGGCTTGAGCATCCATGG - Intergenic
984792180 4:183625038-183625060 ATCAGGGACTTGAGCATCCTTGG - Intergenic
984813205 4:183813520-183813542 GTCAGGGACTTGAGCATCCGTGG + Intergenic
984985186 4:185321963-185321985 ATCAGGGACTTGAATGTCCTCGG + Intronic
985081384 4:186268326-186268348 ATCAGGGACTTGAGCGTTCATGG + Intronic
985205623 4:187532423-187532445 ATCAGGGACTTGAGCATCCCAGG + Intergenic
985296402 4:188441847-188441869 ATCAGGGTCTTGAGCATCCACGG + Intergenic
985411368 4:189689404-189689426 ATCAGGGACTTGAGCGTCTAGGG + Intergenic
985499651 5:234752-234774 ATTAGGGACTTGAGCATCCACGG + Intronic
986257934 5:6116567-6116589 ATCAGGGACTTGAGCATTCCTGG + Intergenic
986587102 5:9329813-9329835 ATCAGGGACTGGAGCATCCATGG - Intronic
986611046 5:9567415-9567437 ATAAGAGACTTGAGCCTCCATGG - Intergenic
987167007 5:15209611-15209633 ATCAGGGGCTTGAGGTTACAGGG - Intergenic
987306686 5:16644098-16644120 ATCAGGGACTTGAGCATCCTTGG + Intergenic
987544613 5:19297206-19297228 ATCAGGGGGTTCAGGGTTCAGGG - Intergenic
987985342 5:25139059-25139081 ATCAGGAACTTGAGTTTCCATGG - Intergenic
988439008 5:31210634-31210656 ATAAGGGACTTGAGCATCCTTGG - Intronic
988791000 5:34607531-34607553 ATCAGGGACTTGAGCATCCATGG + Intergenic
988963815 5:36395128-36395150 ATCAGAGACTTGAGCATCCTTGG - Intergenic
989024199 5:37047155-37047177 ATCAGGGACTTGAGAATCCACGG + Intronic
989126100 5:38053638-38053660 ATAAGGGAGTTGAGCGTCCTCGG - Intergenic
989283027 5:39666517-39666539 ATCAGGGACTTGAGCATCTTTGG - Intergenic
989509129 5:42263444-42263466 ATCAGGTACTTGAGCATCCATGG - Intergenic
989514471 5:42326043-42326065 ATAAGGGACTTGAGCATCCATGG + Intergenic
989975631 5:50583449-50583471 ATAAGAGACTTGAGAATTCATGG + Intergenic
990219062 5:53566626-53566648 ATCAAGGACTTGAGCATCCGTGG - Intronic
990402107 5:55448832-55448854 ATCAGGGACTTGAGCATCCATGG - Intronic
990795064 5:59530412-59530434 ATAAGGAACTTGAGCATCCATGG - Intronic
990845562 5:60134598-60134620 ATCAGGGGCTTGAGCATCCATGG - Intronic
990848193 5:60168590-60168612 ATCAGGGACATGAGCATCCGTGG - Intronic
991580845 5:68153507-68153529 ATCACAGACTTGAGCGTCCCAGG - Intergenic
991603879 5:68380809-68380831 ATCAGGGACTTGAGCATCACTGG - Intergenic
991638934 5:68734336-68734358 ATCAGAGACTTGAACATCCATGG + Intergenic
992313559 5:75528950-75528972 ATCAGGGACTTGAGCAATCGTGG - Intronic
992881211 5:81112393-81112415 ATCAGGGACTTGAGCATCTGTGG + Intronic
992985936 5:82229792-82229814 ATAAGGGACTTGAACATCCATGG + Intronic
993209087 5:84924514-84924536 ATTAGAGACTTGAGCATCCATGG + Intergenic
993940549 5:94052818-94052840 ACCAGGGAGTTGAACGCTCAAGG + Intronic
994118343 5:96086015-96086037 ATTAGAGACTTGAGCATTCATGG - Intergenic
994589118 5:101751920-101751942 ATCAGAGACTTCAGCTTCCATGG + Intergenic
995028926 5:107457380-107457402 ATCAGGGACTTAAGCATTCATGG - Intronic
995134287 5:108663751-108663773 ATATGGGACTTGAGCATTCATGG - Intergenic
995363786 5:111330670-111330692 ATAAGGGACTTGAGCATCCATGG + Intronic
995708374 5:115009342-115009364 ATCAGGGACTTGAGCATCCATGG - Intergenic
995834844 5:116389717-116389739 ATAAGGGACTTGAGCATGCATGG + Intronic
996488747 5:124067537-124067559 ATCAAGGACTTGAGTGATGAAGG - Intergenic
996635767 5:125687932-125687954 ATAAGGGACTTGAGCATTTGAGG - Intergenic
996897929 5:128507336-128507358 ATCAGGGACTTGAGCCTCTATGG - Intronic
996949359 5:129107677-129107699 ATCAGGGACTTGAGCATCCATGG + Intronic
997549812 5:134742127-134742149 ATAAGGGACTTGAGCATCTATGG + Intronic
997555974 5:134799083-134799105 ATAAGGGACTTGAGCATCCTAGG + Intronic
997743853 5:136281319-136281341 ATCAGGCACTTGAGCCATCATGG - Intronic
998527570 5:142856814-142856836 ATCAGATACTTGAGCATCCATGG + Intronic
998708292 5:144790454-144790476 ATATGGTACTTGAGCATTCATGG - Intergenic
998713057 5:144848760-144848782 CTGAGGGACTTGAGCTTTGAGGG + Intergenic
999109422 5:149105343-149105365 ATCAGGGACTTGAGCATCTGTGG - Intergenic
999371470 5:151057903-151057925 ATCAGGGACTTGAGCATCCATGG + Intronic
999472534 5:151868269-151868291 AGCAGGAACTTGAGCTTTTAGGG - Intronic
1000635984 5:163644190-163644212 ATAAGGGCCTTGAGCATCCATGG - Intergenic
1002051605 5:176574584-176574606 GTCAGGGACTTGAGCAGCCATGG - Intronic
1002316061 5:178344181-178344203 GTAAGGGACTTGAGCATCCATGG - Intronic
1002883340 6:1272281-1272303 ATCAGGGACTTGAGCATCCATGG + Intergenic
1003205357 6:4004693-4004715 ATCAGAGATTTGAGCATCCAAGG - Intergenic
1003284521 6:4723283-4723305 ATCAGGGACTTGAGCATCTGTGG + Intronic
1003383511 6:5646634-5646656 ATCAGGGACTTGAGCATCCCTGG - Intronic
1003609870 6:7602241-7602263 ATCAGAGACTTGAGCATCCATGG + Intronic
1003678259 6:8227093-8227115 ATAAGGGACTTGAGCATCCTTGG + Intergenic
1004595210 6:17093181-17093203 ATAAGGGACTTGAGCATCCATGG - Intergenic
1004719924 6:18260108-18260130 ATAAGGGACTTGAGCATCCATGG - Intronic
1005202838 6:23366292-23366314 ATAAGGGACTTGAGCATCCCTGG - Intergenic
1006567249 6:34970494-34970516 ATAAGGGACTTGAGCATCCTTGG - Intronic
1006775551 6:36589726-36589748 ATAAGGGACTTGAGCATCCTTGG - Intergenic
1006888374 6:37401041-37401063 ATCAGGGACTTGAGCATCTGTGG - Intergenic
1006955306 6:37864859-37864881 ATCAGGGACTTGAGCATCCTCGG - Intronic
1006976973 6:38111913-38111935 ATAAGGGACTTGAGCATCTATGG + Intronic
1007216277 6:40241856-40241878 ATCTGGTACTTGAGCATCCATGG + Intergenic
1007334847 6:41148311-41148333 AAAAGGGACTTGAGCATCCATGG - Intergenic
1008209752 6:48705872-48705894 ATAAGGAACTTGAGCATTCCAGG + Intergenic
1008890071 6:56477752-56477774 ATCAGGGACTTGAGCATCATTGG - Intronic
1009481125 6:64159101-64159123 ATCAGGGACTTGAACATCCAGGG - Intronic
1009652772 6:66497621-66497643 ATCAGAGACTTTAGCATTCCTGG + Intergenic
1009891940 6:69695501-69695523 GTAAGGGACTTGAGCATTCGTGG - Intronic
1009913969 6:69969705-69969727 ATAAGGGACTTGAGCATCCATGG + Intronic
1009989440 6:70823590-70823612 ATAAGGGACTTGAGCATTTGTGG - Intronic
1009992908 6:70865549-70865571 ATCAGGGACTTGAGCGTCCATGG + Intronic
1010290084 6:74125537-74125559 ATCTGGAACTGGAGCATTCATGG - Intergenic
1010290122 6:74126337-74126359 ATCTGGAACTGGAGCATTCATGG + Intergenic
1010720548 6:79278488-79278510 ATAAGGGACTTGAGCATCCAAGG - Intergenic
1010753622 6:79642355-79642377 ATAAGGGACTTGAGCATCCAAGG + Intronic
1010940709 6:81914435-81914457 ATCAGAGACTTGAGCATTAGAGG - Intergenic
1011097170 6:83679214-83679236 ATCAGGGACTTGAGCTTCCACGG + Intronic
1011261439 6:85474113-85474135 ATAAGGGACTTGAGCATCCATGG - Intronic
1011989269 6:93492264-93492286 ATAAGGGCCTTGAGTGTCCATGG - Intergenic
1012086780 6:94836730-94836752 ACCAGGGACTTGAGCATTCATGG - Intergenic
1012567038 6:100670361-100670383 ATAAGGGACTTAAGCATCCATGG - Intronic
1013030043 6:106324373-106324395 ATCAGGGACTTGAGCATTTGAGG + Intronic
1013137710 6:107298493-107298515 ATCAGGGACTTGAGCATCCAAGG + Intronic
1013505863 6:110799422-110799444 ATCAGGGACTTGAGCATTCTTGG - Intronic
1013994837 6:116296133-116296155 ATCAAGGACTTCAGCATCCATGG - Intronic
1014459529 6:121679526-121679548 ATCAGGGACTTGAGCATCCATGG + Intergenic
1014487979 6:122024090-122024112 ATTAGGGACTTGAGCATCCACGG - Intergenic
1014768213 6:125431739-125431761 ATCAGGGACTTGAGTATCCATGG - Intergenic
1015372735 6:132473343-132473365 ATCAGGGACTTGAGCATCAGCGG - Intronic
1015629408 6:135216248-135216270 ATCAGGGACTTGAGCATCCCTGG - Intronic
1015645291 6:135380441-135380463 ATTGGGGACTTGAGCATCCAAGG + Intronic
1015894471 6:138003383-138003405 ATCAGGGACTTGAGCATCTGAGG + Intergenic
1015945998 6:138501774-138501796 ATCAGGGACTGGAGCATCCAAGG - Intronic
1016716894 6:147244206-147244228 ATAAGGGACTTGAGCATTATTGG + Intronic
1016848356 6:148591636-148591658 ATCAGGGACTTGAGCATCCAGGG + Intergenic
1016922012 6:149304843-149304865 ATAAGGGACTTGAGCATTTGAGG - Intronic
1016932134 6:149421949-149421971 ATCAGGAACTTGAGCATCCGAGG - Intergenic
1017239901 6:152156499-152156521 ATCAAGGACTTAAGCATCCATGG - Intronic
1017354116 6:153482052-153482074 ATCAAGGAATTGAGCATTCTTGG - Intergenic
1017360075 6:153558167-153558189 ATCAGGGACTTAAGCATCTATGG + Intergenic
1017782274 6:157724894-157724916 ATCAGGGACGTGAGTATCCAAGG + Intronic
1017803179 6:157917620-157917642 ATCAGGGACTTGAGCATCAATGG - Intronic
1018161710 6:161050943-161050965 ATGAGGGACTTGAGCATTTTCGG - Intronic
1018161774 6:161051691-161051713 ATGAGGGACTGGAGCATCCAAGG - Intronic
1018353632 6:162989430-162989452 GTCAGGTACTTGAGCATCCATGG - Intronic
1018381497 6:163261876-163261898 ATCAGGGACTTGAGCATCTGTGG + Intronic
1018410712 6:163544328-163544350 ATCATGGACTTGAGCATTCATGG + Intronic
1018614921 6:165677658-165677680 ATCAGGGACTTGAACGTCGGTGG + Intronic
1018637794 6:165879610-165879632 ATCAGCGACTTGAGCATCCGAGG - Intronic
1019378392 7:708409-708431 ATCAGGGACTTCAGCATCCATGG - Intronic
1019389157 7:775922-775944 ATCAGAGACTTGAGCATTTGAGG + Intronic
1019767370 7:2861585-2861607 ATTAGGGACTTGAGCATCCAGGG - Intergenic
1019830953 7:3329944-3329966 ATCAGCTACTTGAGCATTCATGG + Intronic
1020793468 7:12655053-12655075 ATAAGGGACTTGAGCATTCAAGG - Intergenic
1021492686 7:21236613-21236635 ATCATGGACTTAAGCATCCATGG + Intergenic
1021645717 7:22787520-22787542 ATAAGGGACTTGAGTGTCCATGG - Intergenic
1021964762 7:25906432-25906454 ATCAGTGACTTGAACATCCATGG - Intergenic
1022122473 7:27322953-27322975 ATCAGGGACTTGAGCATCCATGG + Intergenic
1022280977 7:28909053-28909075 ATCAGGAACTTGGGCATCCAGGG - Intergenic
1022321831 7:29295012-29295034 ATAAGAGACTTGAGCATCCATGG - Intronic
1022738062 7:33094452-33094474 ATAAGGGACTTGGGCATCCACGG + Intergenic
1023052000 7:36261009-36261031 ATCAGGGACTTGAGCATCTGTGG + Intronic
1023114707 7:36851349-36851371 ATAAGGGACTTGAGCATCCTGGG + Intergenic
1023253271 7:38287863-38287885 ATCAGGGACTTGAGCATACATGG - Intergenic
1023900241 7:44471178-44471200 ATCAGGGACTTGAGCATCGTTGG - Intronic
1024567303 7:50692218-50692240 ATCAGGGCCTTGAGCATCCTTGG + Intronic
1024672627 7:51609856-51609878 ATCAAGGACTTGAGCATCCTTGG - Intergenic
1024722358 7:52151672-52151694 TTCAGAGACTTAAGAGTTCATGG + Intergenic
1026878015 7:73890748-73890770 GACAGGGCCTTGAGAGTTCACGG - Intergenic
1027186976 7:75978495-75978517 AGCAGGGACTTGAGCATCCTTGG + Intronic
1027344210 7:77240446-77240468 ATCAGGGACTGGAGTATCCATGG - Intronic
1027362409 7:77422821-77422843 TTCAGGGACTTGGGCTTTTAGGG - Intergenic
1027405620 7:77856836-77856858 ATAAGGGACTTGAGCATTCATGG + Intronic
1028507078 7:91582588-91582610 ATAAGGAACTTGAGCATCCATGG + Intergenic
1028520026 7:91719869-91719891 ATAAGGGACTTGAGCATCCATGG + Intronic
1028585089 7:92444844-92444866 ATAAGGGACTTGAGCATTTATGG + Intergenic
1028707012 7:93861204-93861226 ATAAGGGATTTGAGTGTCCATGG + Intronic
1028834476 7:95359057-95359079 ATCAGGGACTTGAGCATCCGTGG - Intergenic
1029219817 7:98979291-98979313 ATCAGGGACTTGAGTGTCCGTGG - Intronic
1030015264 7:105213046-105213068 ATCAAGGACTTGAGCATCCATGG + Intronic
1030180402 7:106702023-106702045 ATCAGGGACTTGCACATTCATGG + Intergenic
1030198142 7:106873631-106873653 ATCAGGGGCTTGAGCATTCATGG + Intronic
1030316073 7:108115792-108115814 ATCAGGGACTTGAGCATCCATGG + Intronic
1030581052 7:111356470-111356492 ATCAGGGATTTGAGCATCCTCGG + Intronic
1030589825 7:111466935-111466957 ATCAGGGACTTGAGCATCTTTGG + Intronic
1030821664 7:114099718-114099740 ATCAGAGACTTGAGCATCCTTGG - Intronic
1030933242 7:115551765-115551787 ATCAAGGACTTGAGCATCCATGG - Intergenic
1031108529 7:117576465-117576487 ATAAGGGTCTTGAGCATTCATGG + Intronic
1031292896 7:119960959-119960981 ATCAGGGACTTGAGCACCTATGG + Intergenic
1031741926 7:125443404-125443426 ATCAGGGACTTGAGCATCCATGG - Intergenic
1032158471 7:129490773-129490795 ATCAAGGACTTGAGCATCCAAGG + Intergenic
1032298532 7:130665687-130665709 ATGAGGGACTTGAGCATCTATGG + Intronic
1032309942 7:130775891-130775913 ATAAGGGACTTGAGCATCCATGG + Intergenic
1032562126 7:132903151-132903173 ATCAGGGACTTGAGCGTTTGTGG - Intronic
1032636495 7:133714754-133714776 ATCAGGTACTTGAGCATCCATGG + Intronic
1032900329 7:136300139-136300161 ATCAGGGACTTGAGCATCTATGG + Intergenic
1032981759 7:137292189-137292211 ATCAGGGACTTGAACATTCATGG - Intronic
1033198103 7:139344316-139344338 GTCAGGGACTTGAGCATCCATGG - Intronic
1033947294 7:146736202-146736224 ATAAGGGATTTGAGCATTCCTGG + Intronic
1034097404 7:148422825-148422847 ATAAGGGACGTGAGCATCCATGG + Intergenic
1034144073 7:148852920-148852942 ATCAGGGACTTGAGTCTTCGTGG - Intronic
1034178543 7:149119938-149119960 ATAAGGGACTTGAGCATCCATGG + Intronic
1034482846 7:151336262-151336284 ATCAGAGACTTGAGCGTTTGAGG + Intergenic
1034498297 7:151434624-151434646 ATCAGGAACTTGAGCATCCTCGG - Intronic
1035131095 7:156654377-156654399 ATCAGGGACTTGAGCATCCTTGG + Intronic
1035438892 7:158879366-158879388 ATGGGGGACTTGAGTATTCATGG - Intronic
1035596386 8:861313-861335 ATAAGGGACTTGAGCATTTGTGG + Intergenic
1035597807 8:872907-872929 ATCAGGGACTTGAGCATCCGTGG - Intergenic
1035718826 8:1775292-1775314 ATAAGGGACTTGAGCATCCGTGG + Intronic
1036282242 8:7410438-7410460 ATCAGGGACTTGAGCATCTGAGG + Intergenic
1036339226 8:7901133-7901155 ATCAGGGACTTGAGCATCTGAGG - Intergenic
1036628661 8:10494874-10494896 ATGAGGAACTTGAGCATCCATGG + Intergenic
1036909062 8:12737562-12737584 ATCAGGGACTTGAGCATCCTTGG + Intronic
1036938714 8:13031109-13031131 TTCAGGGACTTGAGCATCCATGG + Intronic
1037121244 8:15289914-15289936 CTCATGGACTTGACAGTTCAAGG - Intergenic
1037414165 8:18630946-18630968 ATCAGGGACTTGAGTGTCCTTGG + Intronic
1037431747 8:18820442-18820464 ATCAGGGACTTGAACATCCATGG - Intronic
1037471036 8:19211150-19211172 ATGAGGGACTTGAGCATTCCTGG - Intergenic
1037574453 8:20188072-20188094 ATCAGAGACTTGAGCATTCATGG + Intergenic
1038185532 8:25270824-25270846 ATCAGAGACTTGAGCATCCATGG - Intronic
1038392118 8:27211662-27211684 ACCAGGGACTTGAGCATCCTTGG + Intergenic
1038511479 8:28140025-28140047 ATGAGGGACTTGAGCATCCATGG + Intronic
1038599242 8:28922316-28922338 ATAAGGGATTTGAGCATCCATGG + Intronic
1038801257 8:30751041-30751063 ATCAGGGACTTGAGCATCCGTGG + Intronic
1038899038 8:31820974-31820996 ATCAGAGACTAGAGCATCCATGG - Intronic
1039014525 8:33131030-33131052 ATCAGAGACTTGAGCATCCATGG - Intergenic
1039022684 8:33224940-33224962 ATCAGGGACTTGGGCATCCTTGG - Intergenic
1039181889 8:34876225-34876247 ATCAGGGACTTGTGCATTCGTGG - Intergenic
1039393414 8:37201736-37201758 ATCAGGGACTTGAGCTTCCATGG + Intergenic
1040431967 8:47351839-47351861 ATCAGGAACTTGAGCATCCTTGG + Intronic
1040731349 8:50451330-50451352 ATAAGGGACTTGAGCATCCACGG + Intronic
1040869174 8:52082522-52082544 ATCAGGGACTTGAGTTTTGTTGG + Intergenic
1040980851 8:53244925-53244947 ATCAGGGACTGGAGCATCCATGG - Intronic
1040999666 8:53438169-53438191 TTCATGGACTTGAGCTTTAAGGG + Intergenic
1041103560 8:54420050-54420072 ATCAGGGACTTGAGCATCCATGG + Intergenic
1041206345 8:55501898-55501920 ATAAGAGACTTGAGCGTTTGTGG - Intronic
1041595554 8:59646621-59646643 ATAAGGAACTTGAGCATCCATGG - Intergenic
1041720379 8:60969946-60969968 ATAAGGGGCTTGAGCTTTCATGG + Intergenic
1042288233 8:67138267-67138289 ATCAGGAACTTGAGCATCCATGG - Intronic
1042299274 8:67258914-67258936 ATAAGGAACTTGAGCATCCATGG - Intronic
1042445504 8:68880522-68880544 ATCAGGAACTTGAGCATCCATGG - Intergenic
1042511632 8:69618500-69618522 ATCAGAGACTTGAGCATTTGTGG + Intronic
1042570543 8:70159071-70159093 TTCAGGGACTTGAGCATCCATGG - Intronic
1042574229 8:70200163-70200185 ATCAGGGACATAAGCATCCAAGG + Intronic
1042577518 8:70236832-70236854 ATAAGGGACTTGAGCATTGGTGG + Intronic
1042578370 8:70248589-70248611 ATCCAGGACTTGAGCATCCATGG - Intronic
1042783047 8:72513217-72513239 ATAATGGACTTGAGCATCCATGG + Intergenic
1042895763 8:73665790-73665812 ATCAGGGGCTTGAGCAGCCATGG - Intronic
1042992895 8:74660711-74660733 ATCAATTACATGAGCGTTCAAGG + Intronic
1043117690 8:76279645-76279667 ATCACTGACTTGAGCATTCAAGG - Intergenic
1043447191 8:80330663-80330685 ATCTGTGAATAGAGCGTTCAGGG + Intergenic
1043460018 8:80450153-80450175 ATAAGGGACTTGAACATCCATGG - Intergenic
1043540551 8:81257611-81257633 ATCAAAGACTTGAGGGTTCTAGG + Intergenic
1044246253 8:89950257-89950279 ATCAGGGACTTGAGCATCCATGG - Intronic
1045022914 8:98059909-98059931 TTAAGGGACTTGTGCATTCATGG - Intergenic
1045092413 8:98759870-98759892 ATAAGGAACTTGTGCATTCATGG - Intronic
1045185366 8:99831821-99831843 ATAAGGGACTTGAGCATCCGTGG + Intronic
1045306609 8:100962431-100962453 ATAGGGGACTTGAGCATCCATGG - Intergenic
1046653847 8:116872229-116872251 ATAAGCGACTTGAGCATTCGTGG + Intronic
1046837788 8:118822082-118822104 ATTAGGGACTTGAGCATCCTTGG - Intergenic
1047867547 8:129043489-129043511 ATCAGGAACTTGAGCATCCTTGG - Intergenic
1047973286 8:130105362-130105384 ATAAGGCACTTGAGCATTCCTGG + Intronic
1048052855 8:130835660-130835682 ATAAGGGACTTGAACATGCATGG - Intronic
1049050900 8:140194315-140194337 ATCAGGGACTTGAGCAGTTTTGG - Intronic
1049692409 8:143967601-143967623 ATCAGGGACTTGAGCATCTGTGG - Intronic
1049756443 8:144313197-144313219 ATCAGGGATTTCAGTGTTCAGGG - Intronic
1050188421 9:2999249-2999271 ATAAGGGACTTGAGCATCCAAGG - Intergenic
1050223160 9:3419693-3419715 ATGAGGGACTAGAGCATCCATGG - Intronic
1050341238 9:4641322-4641344 ATCAGGGACTTGAGCATTCATGG - Intronic
1050649445 9:7759454-7759476 ATCAGAGACTTGAGCATCCATGG - Intergenic
1051466689 9:17385837-17385859 ATCAGGGACTTGAGCATGGTTGG + Intronic
1051543886 9:18252424-18252446 ATCAGGGACTTGAACATTCAAGG - Intergenic
1051675503 9:19554443-19554465 ATCAGGGACTTGAGCATCCATGG + Intronic
1052662610 9:31454812-31454834 ATCAGGGACTTGAGCATCAGTGG - Intergenic
1053382947 9:37663736-37663758 ATAAAGGACTTGAGCATCCATGG - Intronic
1054727478 9:68666814-68666836 ATAAGGGACTTGAGCATCCATGG + Intergenic
1054769706 9:69072014-69072036 ATCAGGGACTTGAGTACCCACGG + Intronic
1055158666 9:73096913-73096935 ATAAGGAACTTGAGCAGTCATGG - Intergenic
1055169292 9:73235627-73235649 ATCAGGGACTTGAGCATCCATGG + Intergenic
1055601709 9:77925843-77925865 ATCAGGTACTTGAGCATCCTTGG - Intronic
1056120292 9:83480846-83480868 ATAAGGGACTTGAGCATCCTCGG + Intronic
1056213782 9:84389742-84389764 ATCAGGGAACTGAGCATTCTTGG + Intergenic
1056219702 9:84438867-84438889 ATAAGGAACTTGAGCATTCATGG - Intergenic
1056466689 9:86863096-86863118 ATCAGAGACTTGAGCATCCTCGG + Intergenic
1056648954 9:88441269-88441291 ATAAGGGACTTGGGCATCCATGG + Intronic
1057830861 9:98405615-98405637 ATCAGGGACTTGGTCGTTGGGGG - Intronic
1058170766 9:101678436-101678458 ATCAGGGATTATAGCGTGCAGGG - Intronic
1058618016 9:106855659-106855681 ATAAGAGACTTGAGCATCCATGG - Intergenic
1059071260 9:111138960-111138982 ATCAGGTACTTGAGTATCCATGG + Intergenic
1059298656 9:113295494-113295516 ATCAGGGGCTTGAGCATCCTCGG + Intergenic
1059592277 9:115674719-115674741 ATAAGGGACTTGAGCATTACTGG + Intergenic
1059927484 9:119225391-119225413 ATAAGGGACTTGAGCATTCATGG - Intronic
1060131904 9:121109079-121109101 ATAAAGGACTTGAGCATCCATGG - Intronic
1060198479 9:121638343-121638365 GTCAGGGACTTGAGCGTGCTTGG + Intronic
1060519659 9:124287108-124287130 ATCAGGGTCAGGAGCGTACAGGG + Intronic
1060736679 9:126070670-126070692 ATGAGCGACTTGAGGATTCAGGG - Intergenic
1061098667 9:128475252-128475274 ATCAGGGACTTGAGCATCTTTGG + Intronic
1061607448 9:131721901-131721923 ATCAGGGACTTGAGCATCTGTGG + Intronic
1062512623 9:136915615-136915637 ATCAGGGACTCGAGCATCCTTGG + Intronic
1203660457 Un_KI270753v1:36621-36643 ATCAGGGACTTGAGCGTCTAGGG - Intergenic
1203671228 Un_KI270755v1:13578-13600 ATCAGGGACTTGAGCGTCTAGGG - Intergenic
1185783505 X:2869319-2869341 ATCAGAGACTTGAGCATCCGTGG + Intronic
1185821374 X:3208009-3208031 ATCAAGAACTTGAGCATCCATGG - Intergenic
1186285447 X:8038697-8038719 ATCAGGGGCTGGAGCCTGCAAGG - Intergenic
1186424446 X:9452865-9452887 ATCAGGGACATGAGCATCCGTGG + Intergenic
1186493895 X:9996808-9996830 ATCATGGACTTGAGCATCCTTGG + Intergenic
1186555361 X:10552416-10552438 ATCAGAGAGTTGAGCATCCATGG - Intronic
1186662391 X:11682056-11682078 ATAAGGGACTTGAGCATCCATGG - Intergenic
1186676278 X:11821001-11821023 ATTAGGGACTTGAGCATCCATGG + Intergenic
1186930108 X:14379940-14379962 ATAAGGGACTTGAGCATCCTTGG - Intergenic
1186975996 X:14905419-14905441 ATGAGGGACTTGAGCATCCAAGG - Intronic
1187084549 X:16028525-16028547 ATAAGGGACTTGAGTGTCCTTGG + Intergenic
1187328291 X:18312326-18312348 ATCAGGGACTTGAGTGTCCTTGG - Intronic
1187381836 X:18809199-18809221 ATAAGTGACTTGAGCATCCAGGG - Intronic
1188130593 X:26426703-26426725 ATAAGAGACTTGAGCATCCATGG + Intergenic
1188302327 X:28520087-28520109 ATCAGGGACTTAAGCGTCTGAGG - Intergenic
1188408708 X:29844729-29844751 ATCGGGGACTTGAGCATCCTTGG + Intronic
1189149059 X:38685827-38685849 ATCAAGGACTTGAGCATCCTAGG + Intronic
1189221954 X:39380078-39380100 ATAAGAGACTTGAGCATCCAAGG + Intergenic
1189262856 X:39690072-39690094 CTCAGGGACTTGGGGGTCCATGG + Intergenic
1189398475 X:40644672-40644694 ATCAGGGACTTGAGCATCTGTGG + Intronic
1189577145 X:42366110-42366132 ATAAGGGACTTGAGCATCCATGG + Intergenic
1190250415 X:48719758-48719780 ATAAGGGACTTGAGTGTTCACGG + Intergenic
1190513078 X:51194117-51194139 ATGAGAGACTTGAGCATCCATGG + Intergenic
1190934352 X:54982653-54982675 AAAAGGGACTTGAGCATTCATGG + Intronic
1191661133 X:63652504-63652526 ATAAGGGATTTGAGCATCCATGG + Intronic
1192242318 X:69342454-69342476 ATAAGGGACTTGAGCATCCATGG - Intergenic
1193101392 X:77617495-77617517 ATAAGTGACTTGAACTTTCATGG - Intronic
1193584400 X:83303033-83303055 TTCAGAAACTTGAGCATTCATGG + Intergenic
1194134131 X:90117939-90117961 AGCAGGGACTTAAGAGTTCTAGG - Intergenic
1194292954 X:92097789-92097811 ATAAGGGACTTGAGCGTCTAAGG - Intronic
1194414625 X:93595567-93595589 ATAAGGGACTTGAGCATTTGTGG + Intergenic
1194997296 X:100604787-100604809 ATCAGGGACTTGAGCATTCGAGG - Intergenic
1195600130 X:106737393-106737415 ATCAGGGACTTGAGCATCTGTGG - Intronic
1195939218 X:110153613-110153635 ATTAGGGACTTGAGCATCCTTGG - Intronic
1195958001 X:110354514-110354536 ATCAGGAACTTGAGCATTTGTGG + Intronic
1195993813 X:110710964-110710986 ATCAGGGACTTGAGCATCTGTGG - Intronic
1196105465 X:111890496-111890518 ATCAGGGACTTAAACATCCACGG + Intronic
1196388196 X:115182092-115182114 ATAAGAGACTTGAGCATTCGTGG + Intronic
1196710864 X:118760806-118760828 ATCAGGGACTTGAGCATCCATGG - Intronic
1197125379 X:122939941-122939963 ATAAGGGAATTGAGCATCCATGG + Intergenic
1197481590 X:126993824-126993846 ACCAGGGAATTGAGCATTCTTGG + Intergenic
1197669584 X:129261436-129261458 ATCAGGGACTTGAGCATCCTTGG - Intergenic
1197792082 X:130266324-130266346 ACCAGAGACTTGGGAGTTCAGGG + Intronic
1198411274 X:136371845-136371867 ATCAGGAACTTGAGCATCCGTGG + Intronic
1199126479 X:144128178-144128200 ATAAGGGACTTGAGCATTCCTGG - Intergenic
1199286201 X:146057315-146057337 ATCAGGGACTTGAGCATTCTTGG - Intergenic
1199435395 X:147806635-147806657 ATCAGGGATTTGAGCATCCACGG + Intergenic
1199487801 X:148367451-148367473 GTAAGGGACTTGAGCCTCCAGGG + Intergenic
1199610301 X:149606936-149606958 ATCAGGGACTTGAGCATCCATGG - Intronic
1199658710 X:150024636-150024658 ATAAGGAACTTGAGCATTCATGG + Intergenic
1199726200 X:150584744-150584766 ATCAAGGACTTGGGCCTCCAAGG - Intronic
1199983564 X:152934578-152934600 ATCAGGGACTTCAACATGCATGG - Intronic
1200129610 X:153833843-153833865 ATCAGGGATTTGGGTGTCCATGG - Intergenic
1200242264 X:154503272-154503294 ATCAGGGACTTGAGCATCCCTGG - Intergenic
1200245861 X:154524950-154524972 ATCAGGGACTTGAGCATCTGTGG + Intergenic
1200313232 X:155101300-155101322 ATCAGGGACTTGAACATCTATGG + Intronic
1200492656 Y:3847023-3847045 ATAAGGGACTTGAGCATTCATGG + Intergenic
1200610460 Y:5322340-5322362 ATAAGGGACTTGAGCATCTAAGG - Intronic
1200760830 Y:7037263-7037285 ATCAGGGACTTGAGTATCTATGG - Intronic
1201918898 Y:19212905-19212927 ATAAGGTACTTGAGCATTCTTGG - Intergenic
1201919729 Y:19221504-19221526 ATGATGGACTTGAGCTTTGAGGG - Intergenic
1202258318 Y:22943098-22943120 ATGATGGACTTGAGCTTTGAGGG - Intergenic
1202411308 Y:24576856-24576878 ATGATGGACTTGAGCTTTGAGGG - Intergenic
1202459473 Y:25093216-25093238 ATGATGGACTTGAGCTTTGAGGG + Intergenic