ID: 985089196

View in Genome Browser
Species Human (GRCh38)
Location 4:186346155-186346177
Sequence CAGCTGTTTTAGATCATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985089196_985089200 19 Left 985089196 4:186346155-186346177 CCCTTTATGATCTAAAACAGCTG No data
Right 985089200 4:186346197-186346219 ACTAAAAACTAAATAGAGGCTGG No data
985089196_985089201 20 Left 985089196 4:186346155-186346177 CCCTTTATGATCTAAAACAGCTG No data
Right 985089201 4:186346198-186346220 CTAAAAACTAAATAGAGGCTGGG No data
985089196_985089203 28 Left 985089196 4:186346155-186346177 CCCTTTATGATCTAAAACAGCTG No data
Right 985089203 4:186346206-186346228 TAAATAGAGGCTGGGTGTGGTGG No data
985089196_985089198 -6 Left 985089196 4:186346155-186346177 CCCTTTATGATCTAAAACAGCTG No data
Right 985089198 4:186346172-186346194 CAGCTGAAAGTATTGACATAAGG No data
985089196_985089199 15 Left 985089196 4:186346155-186346177 CCCTTTATGATCTAAAACAGCTG No data
Right 985089199 4:186346193-186346215 GGATACTAAAAACTAAATAGAGG No data
985089196_985089202 25 Left 985089196 4:186346155-186346177 CCCTTTATGATCTAAAACAGCTG No data
Right 985089202 4:186346203-186346225 AACTAAATAGAGGCTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985089196 Original CRISPR CAGCTGTTTTAGATCATAAA GGG (reversed) Intergenic
No off target data available for this crispr