ID: 985096326

View in Genome Browser
Species Human (GRCh38)
Location 4:186416334-186416356
Sequence CTCCTGTTTTTGAGGAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985096322_985096326 18 Left 985096322 4:186416293-186416315 CCCGGTGCAGGGAAGGGCATCTT No data
Right 985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG No data
985096323_985096326 17 Left 985096323 4:186416294-186416316 CCGGTGCAGGGAAGGGCATCTTT No data
Right 985096326 4:186416334-186416356 CTCCTGTTTTTGAGGAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985096326 Original CRISPR CTCCTGTTTTTGAGGAGAAA AGG Intergenic
No off target data available for this crispr