ID: 985100503

View in Genome Browser
Species Human (GRCh38)
Location 4:186453505-186453527
Sequence TGAACCACTAAAAAGCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985100503_985100505 -6 Left 985100503 4:186453505-186453527 CCAACCAGCTTTTTAGTGGTTCA 0: 1
1: 0
2: 1
3: 17
4: 138
Right 985100505 4:186453522-186453544 GGTTCATTTTCAACCATGAATGG 0: 1
1: 0
2: 1
3: 14
4: 192
985100503_985100506 4 Left 985100503 4:186453505-186453527 CCAACCAGCTTTTTAGTGGTTCA 0: 1
1: 0
2: 1
3: 17
4: 138
Right 985100506 4:186453532-186453554 CAACCATGAATGGACAGCCAAGG 0: 1
1: 1
2: 1
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985100503 Original CRISPR TGAACCACTAAAAAGCTGGT TGG (reversed) Intronic
903350717 1:22714917-22714939 TGAAGCACAACAAAGCAGGTGGG - Intronic
906261683 1:44396482-44396504 TGAACCACTGGTTAGCTGGTAGG + Intergenic
906847178 1:49205702-49205724 GGAAACATTAAAAAGCTGTTAGG - Intronic
907365665 1:53957393-53957415 TGAACCACTAGAAAGCAGGGTGG + Intronic
907760191 1:57350288-57350310 TACACCACGTAAAAGCTGGTGGG - Intronic
910332903 1:86096546-86096568 TGAACCAATGAAAATGTGGTAGG - Intronic
915449961 1:155997905-155997927 TGAAGCTCAAAAAAGCTGGCTGG - Intronic
915841847 1:159219418-159219440 TGAACCATTAAAAGGCTGTTGGG - Intergenic
916463200 1:165047633-165047655 TTAAACACTACAAAGCTGGCTGG + Intergenic
917350079 1:174067972-174067994 CAAACCACTAAAAGGCTGATAGG + Intergenic
917937734 1:179884803-179884825 TGAACATTTAAAAAGTTGGTAGG - Intronic
918685269 1:187407468-187407490 TGAGGAACTAAAAAGCTGATTGG + Intergenic
920910721 1:210213806-210213828 TGAGGCACTAAAAAGTTGGATGG - Intergenic
923387867 1:233483639-233483661 TGAGGCACTAAAAGGCTGATTGG + Intergenic
1066391650 10:34981537-34981559 TGAACCAGGCAGAAGCTGGTAGG + Intergenic
1068247065 10:54386842-54386864 TGAAACACTACAATGTTGGTTGG + Intronic
1068613446 10:59086154-59086176 GGCACCACTAAAAAGGTGATAGG + Intergenic
1069195843 10:65550456-65550478 TAAAGCACTAAAAAGCTGATTGG + Intergenic
1070173848 10:73953896-73953918 TGAACCACTTCAAAGCTGTTAGG + Intergenic
1075190011 10:120298545-120298567 TGGAGCACTTAAAAGCTGGTAGG + Intergenic
1079787147 11:24687832-24687854 GAAATCACTAAAAAGCTGGTAGG + Intronic
1081746214 11:45474179-45474201 TAAGCCACGAAAAAGCTTGTTGG + Intergenic
1081761865 11:45582235-45582257 TGAACCAGGAAAAGGCTGGAGGG + Intergenic
1083592029 11:63901248-63901270 TGAATTAATAGAAAGCTGGTAGG + Intronic
1086154121 11:83647053-83647075 TGAGGCACTAAAATGCTGATTGG + Intronic
1086563653 11:88198493-88198515 TTGAACACTAAAAAGATGGTAGG - Intergenic
1087770459 11:102203909-102203931 TGAAACACAGAAAAGCTGGAGGG + Intronic
1089116360 11:116098323-116098345 TGAACCACCTTCAAGCTGGTGGG + Intergenic
1089865910 11:121631480-121631502 TGAATCATTAACAACCTGGTGGG + Exonic
1090090303 11:123690967-123690989 TGAGACTCTAAAAAGCTGATTGG + Intergenic
1093159410 12:15728124-15728146 TCCATCACTAAAAAGCTAGTAGG - Intronic
1093838147 12:23861779-23861801 TGAATCACCTCAAAGCTGGTAGG - Intronic
1093918796 12:24836215-24836237 TGAACCAGACAAAAGTTGGTGGG + Intronic
1093938355 12:25025686-25025708 TGATCCAGTCAAAAGCTGATGGG + Intronic
1094153057 12:27307497-27307519 TGAACCACTAAAAGCTTGGCAGG + Intronic
1101237053 12:102800246-102800268 TGATCCACTCAAAAGCAGATAGG - Intergenic
1103262507 12:119600093-119600115 TGAGACACTGAAAAGCTGCTTGG - Intronic
1107638314 13:42415524-42415546 TCCACCACCAAAATGCTGGTGGG + Intergenic
1113658510 13:112087082-112087104 TGAGGCACAAAAAAGCTGATTGG + Intergenic
1114213059 14:20632412-20632434 TCTACCACTCAAAAGGTGGTGGG - Intergenic
1118944811 14:70374772-70374794 TAAAACACTACAAAGATGGTGGG - Intronic
1131359526 15:91778011-91778033 TCCACCCCTAAAAAGCTTGTTGG - Intergenic
1132131856 15:99289392-99289414 AGATACACTAAAAGGCTGGTTGG - Intronic
1133806713 16:9131114-9131136 GGAAACATTAAAAAACTGGTGGG + Intergenic
1134353029 16:13455731-13455753 AGATCCACTAAAAAGCTGAGGGG - Intergenic
1135382949 16:22008865-22008887 GGAGCCACTAGAGAGCTGGTGGG + Intronic
1137466877 16:48717907-48717929 TCAACCAGTAAAAGCCTGGTGGG + Intergenic
1143486419 17:7257596-7257618 TAAAAAACTAAAAAGCTGGCTGG - Intronic
1146007244 17:29168359-29168381 AGGACCAATAAAAACCTGGTGGG + Intronic
1147116929 17:38307643-38307665 TGAATCAAGAAAAAGCTGGGTGG - Intronic
1148412744 17:47481954-47481976 TGAATCAAGAAAAAGCTGGGTGG + Intergenic
1154114324 18:11597771-11597793 TGAGGCACTAAAGAGCTTGTTGG - Intergenic
1160111376 18:76035019-76035041 TGAAGGACAATAAAGCTGGTTGG - Intergenic
925343991 2:3157078-3157100 TGAAACAGGCAAAAGCTGGTTGG - Intergenic
925753856 2:7114865-7114887 TCAAATACTAAAAAGCTGATTGG + Intergenic
931554857 2:63491339-63491361 TGAGGCACTAAAAAACTGATTGG + Intronic
932123944 2:69126542-69126564 TGGATCACTCAAAAGCTGGCAGG - Intronic
932247553 2:70208145-70208167 TGAAGCACTAAAAACCTGTCTGG + Intronic
932275922 2:70452261-70452283 TGAATCCCTGAAAAGCTGGCCGG + Intronic
933026557 2:77267096-77267118 TGAGGCACTAAAAAGCTTATTGG - Intronic
936892620 2:117390107-117390129 TGAACAACAAAAAAGATGGAAGG - Intergenic
939174325 2:138731875-138731897 GAAACCACTAAAAAACTGTTGGG - Intronic
943527550 2:189036678-189036700 TGTACCACGTAAAACCTGGTGGG - Exonic
945109400 2:206348278-206348300 TAAACCTTTAAAAAGGTGGTGGG - Intergenic
945623725 2:212173459-212173481 TGAACCAGTGGAAAGGTGGTGGG + Intronic
946219214 2:218212021-218212043 TGAGACACTAAAAAGCTGAGTGG - Intergenic
1170935588 20:20806219-20806241 TAAAGCACTTAAAGGCTGGTTGG + Intergenic
1171228833 20:23465753-23465775 TTAAGCATCAAAAAGCTGGTAGG - Intergenic
1176729283 21:10475350-10475372 TGGAAAACTAAAAAGCTGGAGGG - Intergenic
1178986470 21:37308559-37308581 TGAAGAACTAAAAAGTTAGTGGG + Intergenic
1179404716 21:41115826-41115848 TGAAAGATTAAAAAGTTGGTTGG - Intergenic
1183169036 22:36171053-36171075 TAAACTACAAAAAAGCTGGTAGG - Intergenic
949383483 3:3471958-3471980 AGAACTATTAAAATGCTGGTTGG + Intergenic
951194817 3:19812424-19812446 AGAACCACTTAAAACATGGTTGG - Intergenic
951644086 3:24867759-24867781 TGGACCACTAAAAATCTGGCAGG - Intergenic
953447696 3:42981528-42981550 TGAACAACTAAAAAGGTGTGGGG + Intronic
955950944 3:64241517-64241539 TAAAATACTGAAAAGCTGGTAGG - Intronic
962501118 3:135994103-135994125 TGAAGCTCTAAAAAGCTGAAGGG + Intronic
963182461 3:142372969-142372991 TGAGGCACTAAATAGCTGATTGG - Intronic
963723631 3:148893380-148893402 TGAACAACAAAAAAACTGGAAGG + Intronic
965792288 3:172402603-172402625 TGAAAGACTAAAAAGCTGATAGG - Intergenic
966774602 3:183532929-183532951 TGAACCCATAAAGAGCTGGGAGG + Intronic
966999410 3:185318013-185318035 AGAACCACTTAAAAGCAGATAGG - Intronic
967343990 3:188433043-188433065 AGAACCACTAAATAGCTTCTTGG - Intronic
970005421 4:11406251-11406273 TTAAGCAATAAAAAGGTGGTGGG + Intronic
978037452 4:104013292-104013314 TTAAGCACTAGAAAGCTGTTTGG - Intergenic
978183341 4:105829294-105829316 TAAACCACTAAAAAGTTGATTGG - Intronic
978645823 4:110930126-110930148 TGAAAATCTAAAAAGTTGGTTGG + Intergenic
980924871 4:139126025-139126047 TGATGGACTAAAAAGCTAGTTGG - Intronic
982474929 4:155838546-155838568 TGAAACAATAAAAAGCAGCTAGG + Intronic
983538633 4:168885009-168885031 TTAACCACTTAAAAGCTGTGTGG - Intronic
985100503 4:186453505-186453527 TGAACCACTAAAAAGCTGGTTGG - Intronic
988419300 5:30986506-30986528 GGAACCACTTAAAAGATGTTAGG - Intergenic
988894205 5:35654276-35654298 TGAAAGAATAAAAAGCTGATGGG + Intronic
989161250 5:38393821-38393843 TGACCCTCTACTAAGCTGGTTGG - Intronic
989771862 5:45154977-45154999 TGATCCACCAGAATGCTGGTAGG - Intergenic
993453543 5:88101191-88101213 TGAAACACTAAAAAGCTGTTTGG + Intergenic
994677946 5:102848536-102848558 TGAGACACTAAAAAGCTGTCTGG - Intronic
997795688 5:136808566-136808588 TCAACAACTTAAAAGCTGGATGG + Intergenic
998025853 5:138815590-138815612 AGAAAAACTACAAAGCTGGTAGG - Intronic
998089156 5:139352773-139352795 TGACCCACTATAAAACTGGCAGG - Intronic
998865085 5:146491123-146491145 TGAAGCACTAAAATGCTGTTTGG + Intronic
999226148 5:150026547-150026569 TCAACCACTAAATAGCTGTGTGG - Intronic
1000156919 5:158561444-158561466 TGAAACACACACAAGCTGGTAGG - Intergenic
1001154538 5:169261789-169261811 TGCAACACAAAAAAGGTGGTCGG + Intronic
1002802771 6:541736-541758 TGAAGAAATAAAAAGCTGGATGG + Intronic
1003852515 6:10239822-10239844 TGAATCTCTAAGAAACTGGTGGG + Intergenic
1005449735 6:25961146-25961168 TAAACCACTATGGAGCTGGTGGG + Intergenic
1005490169 6:26340962-26340984 TGAATCCATAAAAAGGTGGTTGG - Intergenic
1006565830 6:34956444-34956466 TGAGACACTAAAAAGCTGATTGG + Intronic
1008002830 6:46378380-46378402 TAAATCACTCAAAAGATGGTAGG + Intronic
1008039941 6:46786805-46786827 GGATCTACTAAAACGCTGGTGGG + Intergenic
1010073364 6:71770899-71770921 TGAGGCACTAAGAAGCTGATTGG + Intergenic
1011485727 6:87839570-87839592 TGGAGCACTAAAAAGGTGGTTGG + Intergenic
1011706755 6:90008322-90008344 TGAACCACTCAAAACCTGAAGGG + Intronic
1013804408 6:113981517-113981539 TAAACCACTTAAAAGTAGGTTGG + Intronic
1015933756 6:138387897-138387919 TTAACCACTAAAAAGTAGTTTGG + Intergenic
1017252481 6:152296259-152296281 TGAATGACTAGAAAGCTGGGAGG - Intronic
1017835874 6:158177446-158177468 TGACCCCCAAAAAAGCTGATGGG + Intronic
1019920652 7:4161329-4161351 TGAAACACTAAAAGGCTGTCAGG - Intronic
1020705765 7:11542101-11542123 TGAACCTCTAAGAAGTTGGATGG + Intronic
1023294255 7:38698715-38698737 TTAACCAATTAGAAGCTGGTCGG - Intergenic
1023937801 7:44751569-44751591 TTCCCCACTAGAAAGCTGGTTGG - Intronic
1028261538 7:88672740-88672762 TGAAGCACTAGAAAGCTGATTGG - Intergenic
1028463842 7:91126725-91126747 TGAAACACTGAAAAACTGGTGGG - Intronic
1032432184 7:131871117-131871139 AGAACCATTAGAAAGCTGGTAGG - Intergenic
1034600308 7:152246247-152246269 TGGAAAACTAAAAAGCTGGAGGG + Intronic
1036504765 8:9345228-9345250 AGAACCACTAAAAAATTAGTTGG - Intergenic
1038108990 8:24473275-24473297 TCAACTACTCAAAACCTGGTGGG + Intronic
1039617339 8:38966557-38966579 TCAACCCCTATAAAGCTGGAGGG + Intronic
1040350781 8:46565151-46565173 TGTACCAGTAAAATGCTGTTTGG - Intergenic
1041554114 8:59133956-59133978 TGAAGCATCACAAAGCTGGTTGG - Intergenic
1046653421 8:116866117-116866139 TGAGACAGTAAAAAGATGGTAGG - Intronic
1047624839 8:126646238-126646260 TGAGGCACTAACAAGCTTGTGGG + Intergenic
1050625315 9:7497892-7497914 TGAATAACTGAAAAGCTGGAAGG + Intergenic
1051511665 9:17885354-17885376 TGAGCAACCTAAAAGCTGGTTGG - Intergenic
1052159760 9:25242804-25242826 TGTACCACACAAAAGCTGGGAGG + Intergenic
1052290339 9:26833167-26833189 TAAGACACTAAAAAGCTGATTGG - Intergenic
1053185321 9:36011501-36011523 TGGACCAGTAAAAAACTTGTAGG - Intergenic
1053729814 9:41041953-41041975 TGAGGCACTAAAAATCTGCTGGG - Intergenic
1054698694 9:68390110-68390132 TGAGGCACTAAAAATCTGCTGGG + Intronic
1055823263 9:80293567-80293589 TGATCTTCTACAAAGCTGGTTGG + Intergenic
1057025202 9:91729882-91729904 TGAAAAGCTCAAAAGCTGGTGGG + Intronic
1058294801 9:103293198-103293220 AGAACCAATAAAAAGCTACTTGG + Intergenic
1059093415 9:111386258-111386280 AAAACTACTAAAAAGCTGGCCGG - Intronic
1203584978 Un_KI270746v1:58729-58751 TGGAAAACTAAAAAGCTGGAGGG + Intergenic
1186346284 X:8696528-8696550 TGAGCCCCTAAAAAGGTGCTTGG + Intronic
1186616101 X:11189667-11189689 TCAGCCACTAAATATCTGGTGGG + Intronic
1186671841 X:11775139-11775161 TGAATAACTAACAAGGTGGTGGG + Exonic
1187988840 X:24847437-24847459 AGAAACACTAGAAGGCTGGTGGG - Intronic
1188050713 X:25482114-25482136 AGAGCTTCTAAAAAGCTGGTTGG + Intergenic
1188919259 X:35951430-35951452 TGAATAATTAAAAAGCTTGTTGG - Intronic
1192288289 X:69762371-69762393 TGAACCAAGAAAGGGCTGGTTGG - Intronic
1196132879 X:112176397-112176419 TAAACCACGGAAAAGCTAGTTGG - Intergenic
1196920357 X:120579082-120579104 TGAGGCACTAAAAAGCTGGCTGG - Intergenic
1199429522 X:147743528-147743550 TGCACCACAATAAAGCTGGGTGG + Intergenic
1200270083 X:154674581-154674603 TGACCCACAAAACAGCAGGTTGG - Intergenic