ID: 985101318

View in Genome Browser
Species Human (GRCh38)
Location 4:186461319-186461341
Sequence TTCTTGTTCTTTTGTTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10942
Summary {0: 1, 1: 2, 2: 15, 3: 637, 4: 10287}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985101318_985101324 26 Left 985101318 4:186461319-186461341 CCATCTTAACAAAAGAACAAGAA 0: 1
1: 2
2: 15
3: 637
4: 10287
Right 985101324 4:186461368-186461390 GAAAGGGGCCTTCAGTTCTAAGG 0: 1
1: 0
2: 1
3: 5
4: 120
985101318_985101319 3 Left 985101318 4:186461319-186461341 CCATCTTAACAAAAGAACAAGAA 0: 1
1: 2
2: 15
3: 637
4: 10287
Right 985101319 4:186461345-186461367 TGTAGAGAAGTAGCAACACAAGG No data
985101318_985101322 10 Left 985101318 4:186461319-186461341 CCATCTTAACAAAAGAACAAGAA 0: 1
1: 2
2: 15
3: 637
4: 10287
Right 985101322 4:186461352-186461374 AAGTAGCAACACAAGGGAAAGGG 0: 1
1: 0
2: 4
3: 40
4: 361
985101318_985101321 9 Left 985101318 4:186461319-186461341 CCATCTTAACAAAAGAACAAGAA 0: 1
1: 2
2: 15
3: 637
4: 10287
Right 985101321 4:186461351-186461373 GAAGTAGCAACACAAGGGAAAGG 0: 1
1: 0
2: 1
3: 18
4: 277
985101318_985101320 4 Left 985101318 4:186461319-186461341 CCATCTTAACAAAAGAACAAGAA 0: 1
1: 2
2: 15
3: 637
4: 10287
Right 985101320 4:186461346-186461368 GTAGAGAAGTAGCAACACAAGGG 0: 1
1: 0
2: 6
3: 41
4: 245
985101318_985101323 11 Left 985101318 4:186461319-186461341 CCATCTTAACAAAAGAACAAGAA 0: 1
1: 2
2: 15
3: 637
4: 10287
Right 985101323 4:186461353-186461375 AGTAGCAACACAAGGGAAAGGGG 0: 1
1: 0
2: 1
3: 18
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985101318 Original CRISPR TTCTTGTTCTTTTGTTAAGA TGG (reversed) Intronic
Too many off-targets to display for this crispr