ID: 985102767

View in Genome Browser
Species Human (GRCh38)
Location 4:186474789-186474811
Sequence TCTGGCCAAGGGACCGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985102767_985102774 1 Left 985102767 4:186474789-186474811 CCTCCCTCGGTCCCTTGGCCAGA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 985102774 4:186474813-186474835 GAAACTTCTGGATGCCTTCAAGG 0: 1
1: 1
2: 6
3: 25
4: 187
985102767_985102776 20 Left 985102767 4:186474789-186474811 CCTCCCTCGGTCCCTTGGCCAGA 0: 1
1: 0
2: 2
3: 12
4: 191
Right 985102776 4:186474832-186474854 AAGGATGTCTATCTGACCAAAGG 0: 1
1: 0
2: 0
3: 13
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985102767 Original CRISPR TCTGGCCAAGGGACCGAGGG AGG (reversed) Intronic