ID: 985102854

View in Genome Browser
Species Human (GRCh38)
Location 4:186475420-186475442
Sequence TCTCGCAGGCAGACCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985102854 Original CRISPR TCTCGCAGGCAGACCCTGGA GGG Intronic
900343806 1:2201314-2201336 GCTCGAAGGCACAGCCTGGAAGG + Intronic
902777246 1:18682758-18682780 CTTCCCAGGCAGACCCAGGAGGG - Intronic
903052444 1:20611749-20611771 TCTCACAGGCAATCCCTGGCTGG + Intronic
904531444 1:31172323-31172345 TCTTGCAGCCAGAGCCTGCATGG - Intergenic
904586886 1:31585614-31585636 TCCCACAGGCAGCACCTGGAGGG + Intronic
904942072 1:34170885-34170907 TCTAGGAGGCAGAATCTGGAGGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
914955305 1:152156646-152156668 TCTCTCAGGCTGACCATGGTGGG + Exonic
917637998 1:176955738-176955760 TCTGACAGGCAGACCCTGAGGGG + Intronic
918799672 1:188956251-188956273 TCTTGCAGGTGGAGCCTGGAGGG - Intergenic
919887101 1:201942509-201942531 CCTTGGAGGGAGACCCTGGAGGG + Intronic
922976112 1:229784894-229784916 CCTGGCACACAGACCCTGGAAGG - Intergenic
1067308979 10:45094454-45094476 GGTCGCAGCCAGCCCCTGGATGG - Intergenic
1069625846 10:69867231-69867253 TGTGGGTGGCAGACCCTGGAGGG + Intronic
1071825655 10:89322839-89322861 TCTCCCAGGAAGCACCTGGAGGG + Intronic
1073616768 10:105004242-105004264 GCTCCCAGGCAGAGCCTGGCTGG - Intronic
1073799639 10:107027240-107027262 TCACTCAGCCAGATCCTGGAGGG - Intronic
1074051665 10:109886327-109886349 TCTTGCAGGCATCTCCTGGAAGG - Exonic
1076817707 10:132922937-132922959 TCACGACGGCAGCCCCTGGAAGG + Intronic
1077017998 11:405441-405463 CCATGCAGGCAGATCCTGGATGG - Intergenic
1079249712 11:18778512-18778534 TCACGGAGGCAGATCCTGCATGG + Intronic
1083771092 11:64867980-64868002 TCAGGAAGGCAGACCCTGTAAGG - Intronic
1084310048 11:68311868-68311890 TCACCCAGGCACAGCCTGGAAGG - Intergenic
1084458221 11:69281184-69281206 TCACCCAGGCACACCCAGGAGGG + Intergenic
1088859015 11:113782531-113782553 TCTTTCATGTAGACCCTGGAAGG - Intergenic
1089199389 11:116714726-116714748 TCTGGCAGCCAGGCCCTGGCCGG - Intergenic
1091345789 11:134853130-134853152 CCGCGCAGGCAGACCCTGCAGGG - Intergenic
1092095812 12:5841074-5841096 TCTCGCAGGCACCACCTGGCGGG - Intronic
1092145960 12:6214858-6214880 TCACGCAGGCAGGGCCTGGGTGG + Intronic
1095412214 12:41936594-41936616 TATAGCAGGGAGAGCCTGGAAGG - Intergenic
1096009663 12:48202321-48202343 TCTAGCAGGAAGGCCCTGAAAGG - Exonic
1096817376 12:54210128-54210150 ACTCCCAGGGAGACTCTGGAGGG + Intergenic
1104929918 12:132333267-132333289 TCTCTGAGGGAGGCCCTGGAAGG - Intergenic
1112829862 13:103436391-103436413 TCTCCCAGGCAGACACAGAAGGG - Intergenic
1114080481 14:19198774-19198796 CCCTGCAGGCAGACCCAGGAAGG + Intergenic
1116172972 14:41426768-41426790 TCTTGCAGCCAGAGCCTGCATGG + Intergenic
1121127320 14:91416904-91416926 TCTCCCAGGCAGAGACTGGACGG + Intronic
1121406967 14:93725082-93725104 CCTGGCAGGAGGACCCTGGAAGG + Intronic
1122915354 14:104855844-104855866 GCTCCCAGCCAGGCCCTGGAGGG + Intergenic
1128779034 15:70345787-70345809 TCTCAGAGGCTGACCCTGGCTGG - Intergenic
1129294396 15:74591929-74591951 CCTGGAAGGCAGAACCTGGAGGG - Intronic
1131322432 15:91407426-91407448 GCTCTCAGGGAGAACCTGGAAGG + Intergenic
1132233813 15:100204290-100204312 TCTCAAAGGCAGACCCTGTAAGG - Intronic
1132637948 16:962474-962496 CCTGGCAGGCAGACCTTGGCCGG + Intronic
1133056567 16:3148316-3148338 TCTTGCAGGCAGCTCCTGCAGGG + Exonic
1133118299 16:3590735-3590757 TCTGCCTGGCAGTCCCTGGAAGG + Exonic
1133287703 16:4698253-4698275 TCCTGCAGGCAGACCCAGGCAGG - Intronic
1133357230 16:5145465-5145487 TCCCGTGGGCAGATCCTGGATGG - Intergenic
1136022638 16:27449753-27449775 TCCTGGAGGCAGACGCTGGAGGG - Exonic
1136284464 16:29233018-29233040 TCTCCCAGGCAGACCCAGGGCGG + Intergenic
1136716299 16:32286437-32286459 ACCCACAGGCAGACCCTGGGAGG - Intergenic
1136834685 16:33492715-33492737 ACCCACAGGCAGACCCTGGGAGG - Intergenic
1138029462 16:53548499-53548521 TCTAGGAGGTTGACCCTGGATGG + Intergenic
1141915547 16:87094063-87094085 TCTGGCAGGGAGACCCGGGATGG + Intronic
1142089499 16:88202531-88202553 TCTCCCAGGCAGACCCAGGGCGG + Intergenic
1142276783 16:89122997-89123019 GCATGCAGGCAGACCCTGCAAGG + Intronic
1203010118 16_KI270728v1_random:231317-231339 ACCCACAGGCAGACCCTGGGAGG + Intergenic
1203144854 16_KI270728v1_random:1793003-1793025 ACCCACAGGCAGACCCTGGGAGG - Intergenic
1146056422 17:29583606-29583628 TCACCCTGGCAGACCCTGGCTGG - Exonic
1146787263 17:35731505-35731527 TCCCGCAGGGAGAGTCTGGAGGG + Intronic
1146797995 17:35795947-35795969 TCTCGCACCCCGACCCTGGGTGG - Intronic
1148912528 17:50950456-50950478 TGCCGCAGGCACCCCCTGGACGG + Intergenic
1149658812 17:58324111-58324133 TCTCCCTGGCTGGCCCTGGAAGG - Intronic
1151320312 17:73348846-73348868 CCTGGAAGGCAGACCCAGGAAGG - Intronic
1152030332 17:77838227-77838249 TGTCTGAGGCAGGCCCTGGAGGG + Intergenic
1152318424 17:79594455-79594477 TGTGGGAGGCAGAGCCTGGAGGG - Intergenic
1160798468 19:956433-956455 TCTCGGAGGAAGAACGTGGAGGG + Intronic
1162492005 19:10998265-10998287 TCTGGCAGGCAGACCCAACATGG + Intronic
1166364195 19:42270238-42270260 CCTCACAGGCAGAGCCTGGAGGG - Intronic
1167220552 19:48195927-48195949 TCTTGAAGGAAGCCCCTGGAGGG + Intronic
1167712703 19:51122240-51122262 GCTAGCTGACAGACCCTGGAGGG - Intergenic
1167889444 19:52527901-52527923 TATAGCAGACAGACCCGGGACGG - Intronic
1168056763 19:53868769-53868791 ATGCGCAGCCAGACCCTGGAGGG - Intronic
925680876 2:6420226-6420248 TTTCTCAGGAAGATCCTGGAGGG + Intergenic
929782421 2:44965630-44965652 TCCTGCAGGAAGACCCAGGATGG + Intergenic
930054929 2:47244503-47244525 TCTTGCAGGCAGGCCTTGGGAGG - Intergenic
931649361 2:64454363-64454385 CCTGGCAGGCAGAGCCTGGGAGG - Exonic
932430746 2:71672409-71672431 TCTGGCAGGCAGGCCCTCCAGGG + Intronic
933580013 2:84115290-84115312 TCTCAAAGGCAGGCCCTGTAGGG + Intergenic
936498065 2:113039908-113039930 GCATGCAGGCAGATCCTGGAGGG + Intronic
941917625 2:170822778-170822800 TCCCTCAGGCAGGCCATGGAGGG - Intronic
946351426 2:219157098-219157120 TCTTTGAGGTAGACCCTGGATGG - Intronic
948163536 2:235844115-235844137 TCTCACAGGCAGACAATGGATGG - Intronic
1172198902 20:33111631-33111653 CCTGGCAGGCTGACCATGGAAGG - Exonic
1172446248 20:34994971-34994993 TCCTGGAGGCAGTCCCTGGAAGG - Intronic
1172718838 20:36983933-36983955 TCTAACAAGCAGAGCCTGGAGGG - Intergenic
1174339683 20:49887954-49887976 TCAGGCAGGCAGGCCCAGGATGG + Exonic
1175414404 20:58792416-58792438 TCTGCCAGCCAGAGCCTGGATGG + Intergenic
1179897595 21:44371275-44371297 ACACGGAGGCAGACACTGGAGGG - Intronic
1179897605 21:44371311-44371333 ACACGGAGGCAGACACTGGAGGG - Intronic
1180219707 21:46350769-46350791 TCTCGGAGGGAGAGCCTGGAAGG - Intronic
1180500298 22:15923910-15923932 CCCTGCAGGCAGACCCAGGAAGG - Intergenic
1180705344 22:17806245-17806267 TCTCCCGGACAGACCCTGAACGG - Intronic
1181811523 22:25406105-25406127 TCACCCAGGCACAGCCTGGAAGG + Intergenic
1183744270 22:39684369-39684391 TCTGGCTGGCAGACACTGCAGGG - Exonic
950451476 3:13068009-13068031 GCCCGCAGGCAAACCCTGGAAGG + Intronic
950525171 3:13519025-13519047 TCCCCGAGGCTGACCCTGGAGGG + Intergenic
950985244 3:17356853-17356875 TCTAGAAGGCAGACCTTGGGAGG + Intronic
951080231 3:18444405-18444427 TCACGCAGACGGACCTTGGAGGG - Intronic
953034794 3:39202332-39202354 TCACGCAGGCAGTCCCTGAGGGG + Intergenic
953904056 3:46859422-46859444 TCTCCCAGGATGTCCCTGGAAGG + Intronic
953996073 3:47521060-47521082 TCTGTCAGGGAGACACTGGAAGG + Intergenic
954300860 3:49700068-49700090 TCCCTCAGTCAGACCCCGGAAGG + Intronic
960568089 3:119156490-119156512 TCTCCCAGGAAGCACCTGGATGG - Intronic
968933699 4:3597984-3598006 TCTCCCTTGCAGACCCAGGAGGG - Intergenic
969251711 4:5972696-5972718 CCCCACAGGCAGAGCCTGGAGGG + Intronic
969807939 4:9625372-9625394 TCCCGTGGGCAGATCCTGGATGG + Intergenic
985102854 4:186475420-186475442 TCTCGCAGGCAGACCCTGGAGGG + Intronic
985607141 5:863894-863916 TCTCCCAGGCAGGCCATGGTAGG - Intronic
986796120 5:11213704-11213726 TCTCCCAGGCATTCCATGGAAGG + Intronic
991474431 5:67004334-67004356 CCTCCCAGCCGGACCCTGGAAGG + Intronic
994216333 5:97142573-97142595 TCACACAGGCAGACCCAAGATGG - Exonic
997677443 5:135723649-135723671 GCTTACAGGCAGGCCCTGGAAGG - Intergenic
998151007 5:139757490-139757512 TCTGCCAGGCAGTCCCTGAAGGG + Intergenic
1000037809 5:157461996-157462018 ACTCCCAGGCAGTGCCTGGAAGG - Intronic
1005664172 6:28033964-28033986 TTTCTCAGGCAGACCCAGGCTGG + Intergenic
1007703157 6:43775953-43775975 TCTGGAAAGCAGACCTTGGAGGG + Intronic
1019320971 7:415132-415154 TCACCCAGGCTGAGCCTGGAGGG - Intergenic
1019320988 7:415189-415211 TCACCCAGGCTGAGCCTGGAGGG - Intergenic
1019435478 7:1020254-1020276 TCTCTCAGGGAGCCCCAGGAGGG - Intronic
1019576001 7:1737945-1737967 TCCCACAGGCAGGGCCTGGAGGG - Intronic
1022530012 7:31061209-31061231 TGTTGCAGGCAGATCCTGCAAGG - Intronic
1027866059 7:83648611-83648633 TCTCGCACGCTGCCCCTGGAGGG - Exonic
1029650180 7:101886166-101886188 TATGGAAGGCAGACCCTGTAGGG - Intronic
1032687603 7:134251398-134251420 TCTCCCTCACAGACCCTGGAAGG + Intronic
1035522260 8:284282-284304 TGTCAGAGGCAGACCCCGGAGGG - Intergenic
1039610930 8:38918907-38918929 TCTCACTGGCAGATCCTGGCTGG - Intronic
1043655547 8:82661124-82661146 TCTCGAAGGCAGAAGATGGATGG + Intergenic
1048230510 8:132635963-132635985 TCTCCCTCGCAGCCCCTGGAAGG + Intronic
1049604547 8:143523193-143523215 TCTGGTGGGCAGACCCTGGCTGG + Intronic
1054456445 9:65433832-65433854 TCTCCCTTGCAGACCCAGGATGG + Intergenic
1057184761 9:93050934-93050956 AAGCGCAGGGAGACCCTGGATGG + Intergenic
1058599717 9:106656212-106656234 TCTGGCAGGAAAACACTGGACGG - Intergenic
1061634656 9:131899690-131899712 TCTCGATGGCAGAGCCAGGAGGG - Intronic
1062047584 9:134431646-134431668 CCCCGCAGGCAGACCCTAGAGGG + Intronic
1062354526 9:136155477-136155499 TCTCTCGGGTAGTCCCTGGAAGG - Intergenic
1062388613 9:136325148-136325170 TCCAGAAGGGAGACCCTGGAGGG - Intergenic
1189523219 X:41792082-41792104 TCTGATAGGCAGACCCTGGTGGG - Intronic
1192207489 X:69106072-69106094 TGTTGCAAGCAGACCCTGGTGGG + Intergenic
1199299830 X:146199992-146200014 GCTTGCAGTCAGACTCTGGAAGG - Intergenic
1200983222 Y:9280909-9280931 TCTTGCAGGAAGACCTAGGAAGG - Intergenic
1202127162 Y:21578787-21578809 TCTTGCAGGAAGACCTAGGAAGG + Intergenic