ID: 985104820

View in Genome Browser
Species Human (GRCh38)
Location 4:186489989-186490011
Sequence ACTCCTGGTTTTGATCAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985104816_985104820 21 Left 985104816 4:186489945-186489967 CCCTGTTTTCTTATACATTGTTA 0: 1
1: 2
2: 0
3: 45
4: 525
Right 985104820 4:186489989-186490011 ACTCCTGGTTTTGATCAGTCAGG 0: 1
1: 0
2: 0
3: 20
4: 133
985104815_985104820 26 Left 985104815 4:186489940-186489962 CCTGGCCCTGTTTTCTTATACAT 0: 1
1: 0
2: 4
3: 49
4: 441
Right 985104820 4:186489989-186490011 ACTCCTGGTTTTGATCAGTCAGG 0: 1
1: 0
2: 0
3: 20
4: 133
985104817_985104820 20 Left 985104817 4:186489946-186489968 CCTGTTTTCTTATACATTGTTAT 0: 1
1: 14
2: 72
3: 141
4: 583
Right 985104820 4:186489989-186490011 ACTCCTGGTTTTGATCAGTCAGG 0: 1
1: 0
2: 0
3: 20
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985104820 Original CRISPR ACTCCTGGTTTTGATCAGTC AGG Intronic
900731170 1:4261588-4261610 ACTCCTGATTTTAGTCTGTCAGG - Intergenic
902677274 1:18017524-18017546 CCTCCTGGTCTTGGTCAGTTCGG + Intergenic
910578835 1:88798779-88798801 ACTCATGGTTGTCATCATTCTGG - Intronic
915113629 1:153581338-153581360 TGTCCTGGCTTTGATAAGTCTGG - Intergenic
916572069 1:166036734-166036756 ACTCCTGATTGTCATGAGTCAGG - Intergenic
918024632 1:180731372-180731394 ACCCCTTGTTTTAGTCAGTCAGG - Intronic
919239400 1:194892048-194892070 ACCCCTGGTTTTAGTCAGTCAGG - Intergenic
920764027 1:208813700-208813722 ACCCCTGATTTTAGTCAGTCAGG - Intergenic
921230624 1:213066684-213066706 ACTCCTAATTTTAGTCAGTCAGG - Intronic
924308513 1:242716502-242716524 ACTGCTGGTTTTGATGAGGAAGG - Intergenic
1064816412 10:19270022-19270044 ACTGCTGGTTTTGCTGAGTGTGG + Intronic
1066458091 10:35588961-35588983 CCTTCTGTTTTTGATCACTCTGG + Intergenic
1066539186 10:36426262-36426284 ACCCCTGATTTTATTCAGTCAGG + Intergenic
1068215428 10:53977080-53977102 ACCCCTGATTTTAGTCAGTCTGG + Intronic
1082769392 11:57195008-57195030 AAACCTGGTTTGGATCAATCTGG + Intergenic
1084918000 11:72445261-72445283 ACCCCTAGTTTTAATCAGTCAGG - Intergenic
1086750109 11:90482275-90482297 ACCCCTGCTTTTAGTCAGTCAGG + Intergenic
1086943527 11:92822339-92822361 ACTGCTAATTTGGATCAGTCTGG + Intronic
1087483497 11:98732207-98732229 ACTCCTGTTGTTGGTCAGGCTGG + Intergenic
1090160886 11:124493572-124493594 AATCCTCTTTTTGACCAGTCTGG - Intergenic
1094099753 12:26749191-26749213 ACTCATGGTTATGATTAGTTAGG + Intronic
1097672156 12:62553452-62553474 ACTCCTGGTTTTTACCATTTGGG - Intronic
1099080695 12:78176660-78176682 AATTCTGGTTTTGAGTAGTCTGG + Intronic
1100927562 12:99567006-99567028 TCTCCTGCTTTTCATCAGTCAGG + Intronic
1102940741 12:116939316-116939338 ACTCCTGGTTTTAAGCATTTTGG + Intronic
1107239724 13:38217780-38217802 ACTCCTGGGTGTGTTTAGTCAGG - Intergenic
1107348880 13:39493056-39493078 ACTCCTGCTGTTGGTCATTCAGG + Intronic
1108193062 13:47963042-47963064 ACCCCTGGTTTTAGTCAGTCAGG + Intronic
1108752057 13:53457818-53457840 ACCCCTAGTTTTAGTCAGTCAGG - Intergenic
1108855625 13:54789425-54789447 ACTCCTAGTTTTAGTCAGTTAGG - Intergenic
1108871784 13:54996374-54996396 ACCCCTGGTTTTAGTCAGTTAGG + Intergenic
1108908375 13:55508803-55508825 AAGCCTAGTTTTGGTCAGTCAGG - Intergenic
1111203565 13:84972979-84973001 ACCCTTGGTTTTAGTCAGTCAGG - Intergenic
1111555877 13:89880760-89880782 ACCTCTGGTTTTAGTCAGTCAGG - Intergenic
1115718429 14:36131902-36131924 ACTGCTGCTTTTGAGAAGTCAGG + Intergenic
1118409373 14:65461822-65461844 AACCCTGGTTTTAGTCAGTCAGG - Intronic
1123046294 14:105518011-105518033 ACCCCTGGTTTTAGTGAGTCAGG + Intergenic
1123813970 15:23957733-23957755 ACCCCTGGTTTTAGTCAGTCAGG - Intergenic
1124687980 15:31798618-31798640 ACTCCTGGTTATCCTCAGTGAGG - Intronic
1126609459 15:50514471-50514493 ACTCCTGGGCTTAAGCAGTCGGG - Intronic
1127106307 15:55620300-55620322 GCTCGTGGATTCGATCAGTCTGG - Intronic
1129314157 15:74731165-74731187 GCTCCTGGTATTGATCACTAGGG - Intergenic
1131939546 15:97545862-97545884 ACTCCTAATTTTAATCAGTTGGG - Intergenic
1132016164 15:98319191-98319213 ACCTCTAGTTTTAATCAGTCAGG + Intergenic
1132399264 15:101495561-101495583 CATCCTGGTTTTGCTCAATCTGG - Intronic
1133450510 16:5900083-5900105 ACTCCTGGTTTTGTTTTGTTTGG - Intergenic
1135942396 16:26834006-26834028 ACCCCTAGTTTTAGTCAGTCAGG + Intergenic
1138494580 16:57400008-57400030 ACTCCTGGTTTTAGTCAATCAGG - Intergenic
1138589061 16:57989772-57989794 ATTCTTGGTTTGGATCTGTCTGG - Intergenic
1138742985 16:59332210-59332232 ACTCCTGGTTTTAGTTAATCAGG + Intergenic
1144197843 17:12912712-12912734 ATTGCTGCTTTTGCTCAGTCTGG - Intronic
1144423693 17:15121185-15121207 AAGCCTGAGTTTGATCAGTCCGG + Intergenic
1145725437 17:27116898-27116920 ACCCCTAGTTTTCATCAGTCAGG - Intergenic
1153655351 18:7277333-7277355 ACTCCTGGTTTTGGCCAAACAGG - Intergenic
1157683118 18:49622343-49622365 GTTCCTGGTTTTGAACAGTTGGG + Intergenic
1159333901 18:67038579-67038601 ACTCCTAATTTTAGTCAGTCAGG - Intergenic
1161999471 19:7734197-7734219 TCTCCTGGTTTTGTTGAGGCAGG + Intergenic
1162010449 19:7810425-7810447 ACTCCTAATTTCAATCAGTCAGG - Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
925674635 2:6348894-6348916 ACTCCTGAATTTGATCAATGTGG - Intergenic
929397111 2:41535703-41535725 ACCCCTAGTTTTAGTCAGTCAGG + Intergenic
931964492 2:67518282-67518304 ACCCCTGGTTTTAGTCAGTCAGG - Intergenic
934477402 2:94602636-94602658 ACACCTGGTCTTGCCCAGTCTGG - Intronic
935164682 2:100560320-100560342 ACCCCTAGTTTTAGTCAGTCGGG - Intergenic
935211545 2:100943218-100943240 ACTTCTTGTTTTTGTCAGTCTGG + Intronic
935356975 2:102210393-102210415 TCTCCTGCTTTTGATCTGTCTGG - Intronic
935938981 2:108218709-108218731 ACTCATGGTTTTAAAAAGTCTGG - Intergenic
938175889 2:129128431-129128453 ACTCCTAATTTTAGTCAGTCAGG + Intergenic
938400291 2:130985474-130985496 ACCCCTAGTTTTAGTCAGTCAGG - Intronic
939802091 2:146722184-146722206 ACCCCTCGTTTTAGTCAGTCAGG + Intergenic
948191139 2:236060119-236060141 ACTCAAGGCTTTGATCAATCTGG - Intronic
948483472 2:238264833-238264855 ACTCCTGGTTTCAAACAGGCTGG + Intronic
1169042956 20:2510821-2510843 ACCCCTGATTTTGGTCAGTCAGG - Intronic
1172677665 20:36685782-36685804 ACTCCTGGGCTTGAGCAATCTGG - Intronic
1173376302 20:42486681-42486703 TCTCCTGGTGTGGATCAGCCAGG + Intronic
1173382434 20:42558067-42558089 ACCCCTGGTGTTCATCACTCAGG + Intronic
1174166280 20:48585848-48585870 ACCCTAGCTTTTGATCAGTCAGG - Intergenic
1174838756 20:53881747-53881769 ACGCCTGGTTTTGAAAAGTAGGG + Intergenic
1176912267 21:14580319-14580341 ATTTCTGGATTTCATCAGTCTGG - Intronic
1177126030 21:17193648-17193670 ACTCCTGGCTGATATCAGTCAGG - Intergenic
1177299626 21:19226092-19226114 AATACTGGTTTTAATTAGTCCGG + Intergenic
1177879169 21:26671155-26671177 ACCCCTGTTTTTAATCAGTCAGG - Intergenic
1178280668 21:31280050-31280072 ACTGCTGGATTTCATCAGTATGG - Intronic
1179236518 21:39552067-39552089 ACCCCTGGTTTTAGTCAGTCAGG - Intergenic
1180887152 22:19253988-19254010 ACTTCTGGTACTCATCAGTCCGG + Exonic
1181403553 22:22666505-22666527 TCTAGTGGTTTTGTTCAGTCCGG - Intergenic
1181408556 22:22702476-22702498 TCTAATGGTTTTGTTCAGTCAGG - Intergenic
1181730010 22:24838344-24838366 ACACCTAGTTTTAGTCAGTCAGG - Intronic
1182187749 22:28424788-28424810 CCTCCTGGATTACATCAGTCAGG + Intronic
950401620 3:12773442-12773464 ACCGCTGGTTTTAGTCAGTCAGG - Intergenic
950866419 3:16192994-16193016 ATTCCTGGTTTTGCTCATTGTGG + Intronic
955364774 3:58301523-58301545 ACTCCTAATTTTAGTCAGTCAGG - Intergenic
959638350 3:108601927-108601949 ACCCCTAGTTTTAGTCAGTCAGG + Intronic
962409138 3:135126281-135126303 ACTCCTAGGTATTATCAGTCAGG - Intronic
964137654 3:153363347-153363369 ACTACTATTTTTAATCAGTCAGG - Intergenic
965662628 3:171057653-171057675 ATGCCTAGTTTTGGTCAGTCAGG - Intergenic
965679222 3:171233277-171233299 AGTGCTGGTTATGATCAGTGGGG - Intronic
968409511 4:376889-376911 ACTCCTTGTTTTTATTTGTCTGG + Intronic
972348722 4:38215513-38215535 ACCCCTAGTTTTAGTCAGTCAGG - Intergenic
973045276 4:45529467-45529489 ACCCCTGGTTTTAGTCAGTCAGG + Intergenic
974618420 4:64322248-64322270 ACCCCTAGTTTTAGTCAGTCAGG + Intronic
975450173 4:74516666-74516688 ACTCCTGGTTTTCATGAGAAGGG - Intergenic
976633402 4:87263013-87263035 ACTCCTAGTTTTAATTAGTCAGG + Intergenic
984030917 4:174603057-174603079 ACTCCTAGTTTTAGTCAGTCAGG + Intergenic
984091613 4:175381767-175381789 TCTCTTGGTTTTTATCTGTCTGG - Intergenic
984937146 4:184899343-184899365 ACACCTGCTTTTTATCTGTCTGG - Intergenic
985104820 4:186489989-186490011 ACTCCTGGTTTTGATCAGTCAGG + Intronic
985156488 4:186993476-186993498 TCCCCTGGTTTTAATCAGTCAGG + Intergenic
985234289 4:187856152-187856174 ACCCTTAGTTTTGGTCAGTCAGG - Intergenic
988039590 5:25872624-25872646 ACCCCTAGTTTTAGTCAGTCAGG + Intergenic
990520015 5:56570622-56570644 ACTCCTGGCTTTGATGAAGCAGG - Intronic
993136510 5:83973168-83973190 AAGCCTGATTTTGATTAGTCTGG + Intronic
993647835 5:90481240-90481262 CCTCTTGGTATTGATCAGGCTGG - Intronic
997607327 5:135184462-135184484 AATCCTGATTTTGATCTGGCAGG + Intronic
999598858 5:153237714-153237736 ACTGCTGCTTTTGATAATTCAGG + Intergenic
1000540855 5:162538125-162538147 ACCCCTAGTTTTAGTCAGTCAGG - Intergenic
1004781957 6:18919266-18919288 ACACCTGTTTCTGATCACTCTGG - Intergenic
1004782047 6:18920261-18920283 TTTCCTGGTTTTGTTTAGTCTGG + Intergenic
1005035157 6:21549224-21549246 ACTCCTAATTTTAGTCAGTCAGG - Intergenic
1006577324 6:35056146-35056168 CCTCTTGGATTTGATAAGTCGGG + Intronic
1006873339 6:37273295-37273317 ACTCCTGGTTGTGACCAGAATGG - Intronic
1010519414 6:76814367-76814389 ATTCCTGGTTCTCATCTGTCAGG - Intergenic
1011126897 6:84017344-84017366 ACTCTAGGTTTTAATCAGGCAGG + Intergenic
1012176757 6:96096461-96096483 ACTCCAGATTTTAATCAGTGAGG - Intronic
1018467097 6:164057875-164057897 ACTCCTTACTTTCATCAGTCAGG + Intergenic
1023348616 7:39296802-39296824 ACACCTGGTTTTGTTCACTATGG + Intronic
1024224731 7:47317429-47317451 ATTCAAGGTTTTGATCAGACTGG + Intronic
1027666764 7:81049626-81049648 ACTGCTAGTTTTACTCAGTCAGG + Intergenic
1028426845 7:90699224-90699246 TCTCTTGGTTCAGATCAGTCTGG - Intronic
1029021827 7:97372210-97372232 ACCCCTAATTTTAATCAGTCAGG + Intergenic
1030443421 7:109618463-109618485 ACCCCTGGTTTTAGTCAGTCAGG - Intergenic
1032634126 7:133687576-133687598 ACCCTTAGTTTTGGTCAGTCAGG + Intronic
1041115131 8:54527738-54527760 AGTCCTGGGTTTTATCAGCCGGG - Intergenic
1044014021 8:87028578-87028600 ACCCCTAGTTTTAATCAGTCAGG - Intronic
1045310510 8:100997617-100997639 ACCCTGGGTTTTAATCAGTCAGG - Intergenic
1046317674 8:112528713-112528735 TCTGCTAGTTTTGGTCAGTCTGG - Intronic
1046345985 8:112927857-112927879 ACTGTTGGTTATAATCAGTCTGG + Intronic
1047080718 8:121457132-121457154 ACTCCTAATTTTAGTCAGTCAGG + Intergenic
1047662827 8:127056788-127056810 TCTCCTGGCTTTGATCATTTTGG + Intergenic
1049975109 9:854024-854046 ACTCCTGGCTTCCAGCAGTCAGG + Intronic
1049992311 9:1001623-1001645 CCTCCTGCTTTAGATCAGCCTGG - Intergenic
1051136131 9:13923624-13923646 ACCCCTAGTTTTAGTCAGTCAGG - Intergenic
1051937718 9:22464699-22464721 ACTCCTTCATTTGATCACTCAGG + Intergenic
1053512836 9:38703562-38703584 GCTCCTGGTTTTGGTCAGGTGGG - Intergenic
1056470965 9:86904159-86904181 ACTATTGGTTTTGAAGAGTCTGG + Intergenic
1057149464 9:92783544-92783566 ACCCCTGGTTTTAGTCAGTCAGG - Intergenic
1059049563 9:110909142-110909164 ACCCGTGGTTTTAGTCAGTCAGG + Intronic
1062211788 9:135368618-135368640 ACCCCTAGTTTTAGTCAGTCAGG + Intergenic
1187479852 X:19645417-19645439 ATTTCTGTTTTTGATGAGTCTGG + Exonic
1190279367 X:48919075-48919097 CCACCTGGCTTTGATCAATCCGG + Intergenic
1194332661 X:92602050-92602072 ACTCCTGCTTTTTAGCAGACAGG - Intronic
1196541532 X:116916275-116916297 ACTCCTTGTTTTGGGCAGGCAGG + Intergenic
1200808078 Y:7453238-7453260 ACTCCTGGTTTTGAAGACACAGG + Intergenic
1201728780 Y:17184125-17184147 ACCCCTGATTTTAATCAGTCAGG + Intergenic