ID: 985104915

View in Genome Browser
Species Human (GRCh38)
Location 4:186490707-186490729
Sequence CTAATCAGTCTTTTGTTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 285}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985104915_985104919 27 Left 985104915 4:186490707-186490729 CCCCCTAACAAAAGACTGATTAG 0: 1
1: 0
2: 1
3: 31
4: 285
Right 985104919 4:186490757-186490779 ACGAAAGTTTTACATGACCCAGG 0: 1
1: 0
2: 3
3: 31
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985104915 Original CRISPR CTAATCAGTCTTTTGTTAGG GGG (reversed) Intronic