ID: 985105195

View in Genome Browser
Species Human (GRCh38)
Location 4:186492784-186492806
Sequence TTAGTGGCCTGACTCTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985105188_985105195 17 Left 985105188 4:186492744-186492766 CCACCATGTGATTAGGGAGTCGA 0: 1
1: 0
2: 0
3: 3
4: 37
Right 985105195 4:186492784-186492806 TTAGTGGCCTGACTCTGAGGAGG 0: 1
1: 0
2: 1
3: 8
4: 125
985105190_985105195 14 Left 985105190 4:186492747-186492769 CCATGTGATTAGGGAGTCGAGGG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 985105195 4:186492784-186492806 TTAGTGGCCTGACTCTGAGGAGG 0: 1
1: 0
2: 1
3: 8
4: 125
985105187_985105195 18 Left 985105187 4:186492743-186492765 CCCACCATGTGATTAGGGAGTCG 0: 1
1: 2
2: 11
3: 58
4: 175
Right 985105195 4:186492784-186492806 TTAGTGGCCTGACTCTGAGGAGG 0: 1
1: 0
2: 1
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985105195 Original CRISPR TTAGTGGCCTGACTCTGAGG AGG Intronic
900941213 1:5799891-5799913 GTGGTGACCTGACTATGAGGAGG + Intergenic
902176857 1:14656986-14657008 TTGGTGGCCTGACTGTGTAGTGG - Intronic
905491768 1:38349818-38349840 ATAGAGGCCAGAGTCTGAGGTGG - Intergenic
911016847 1:93342774-93342796 CTAGTGTCCTGACTATGATGTGG - Intergenic
911259845 1:95672753-95672775 GTGGTGGCCAGACTCTAAGGTGG + Intergenic
917440827 1:175067347-175067369 TGAGTGGCAGGACTCTGAAGTGG - Intergenic
917609945 1:176678644-176678666 TTACTGGCCTGACTCCCAGCAGG - Intronic
1067316596 10:45171822-45171844 TTTTTGTCCTGACTCTGATGTGG - Intergenic
1071020863 10:81053662-81053684 GTAGTGGCCTGAGGCTGCGGTGG + Intergenic
1074807563 10:117068505-117068527 CAAGTGGCCTGGCTCTGAAGGGG + Intronic
1074807636 10:117069381-117069403 CAAGTGGCCTGGCTCTGAAGGGG + Intronic
1079533658 11:21485405-21485427 TTGGAGGCCTGCCACTGAGGAGG - Intronic
1080029227 11:27643409-27643431 TCAGTGGCCAGACTATGTGGTGG + Intergenic
1080210602 11:29780999-29781021 CTGGTGGGCTGACTCTGAGGGGG - Intergenic
1080631252 11:34078852-34078874 TTTGTGGCCTCACTCTGATTGGG + Intronic
1087288367 11:96291883-96291905 TGAGTGGCTGGACTCTGGGGTGG + Intronic
1088566395 11:111177431-111177453 TGAGTGGCCTGAATCTGGTGAGG + Intergenic
1088809206 11:113378755-113378777 TTAGTGGCCTGACCCTGGGGAGG + Intronic
1090255981 11:125284765-125284787 CTAGTGTCCTTTCTCTGAGGAGG - Intronic
1092500027 12:9036241-9036263 GCTGTGGCCTGACTGTGAGGCGG + Intergenic
1093402933 12:18768371-18768393 TTATTTTCCTGACTCTGAGGTGG - Intergenic
1095957856 12:47817003-47817025 TTAGAGGCCTGAGTATTAGGAGG - Intronic
1096073243 12:48787671-48787693 TTAGGAGCCTGACTCTGGGGAGG - Intronic
1096093879 12:48921706-48921728 ATGGTGCCCTGATTCTGAGGAGG - Intronic
1096504139 12:52082117-52082139 TTCCTGGCCTGAACCTGAGGGGG + Intergenic
1103123681 12:118402391-118402413 TTCGTGGCCTGACTCTGGTAAGG + Intronic
1103587299 12:121965930-121965952 TTGGTGGCCTGAGGCTAAGGTGG - Intronic
1107630138 13:42334510-42334532 GTTCTGGCCTGAATCTGAGGAGG - Intergenic
1108786341 13:53906710-53906732 TTACTGGCCTGACTCCCAGCAGG + Intergenic
1110408500 13:75177576-75177598 TTAGTAGCCTCACATTGAGGGGG + Intergenic
1111456009 13:88485342-88485364 TTACTTTTCTGACTCTGAGGTGG - Intergenic
1114510184 14:23252357-23252379 TTAATGGGCTGATTTTGAGGGGG - Intronic
1118049040 14:62005876-62005898 TTAATGCCCTGGCTCTGTGGTGG + Intronic
1130703589 15:86211056-86211078 TTAGGGACCTGACTCTTAGAAGG - Intronic
1130997419 15:88911764-88911786 TTAGATGGGTGACTCTGAGGGGG - Intronic
1137594108 16:49712586-49712608 TTAGAAGCTTGAGTCTGAGGAGG - Intronic
1140107127 16:71971106-71971128 CTACTGGCCTGAATTTGAGGGGG - Intronic
1140221770 16:73048662-73048684 TGAGTGGCCTGGCTGTGACGTGG - Intronic
1142786624 17:2229270-2229292 TGAGTGGCGTGACACTCAGGTGG - Intronic
1145837033 17:27962204-27962226 CTTGTGGCTTGACTCTCAGGGGG - Intergenic
1147317887 17:39629523-39629545 TTGGTGGCCTTCCTCAGAGGAGG + Exonic
1149963405 17:61137046-61137068 TTAGTGGCATTATTATGAGGTGG + Intronic
1164311230 19:24048260-24048282 TTAGAGGCCGGCCACTGAGGTGG + Intronic
1165523289 19:36331235-36331257 TTAGTGGACTGTCTCTGATAAGG - Intergenic
1165573955 19:36798013-36798035 TTAGTGGACTGTCTCTGATAAGG + Intergenic
1165633138 19:37318389-37318411 TTAGTGGACTGTCTCTGATAAGG + Intronic
1166555969 19:43700053-43700075 TGAGTGGCCTTAGTCTGAGCGGG - Intergenic
1166769371 19:45271743-45271765 ATAGGGGCCTGACTGTGGGGAGG - Intronic
1167412973 19:49355894-49355916 CTAGTGCCCTGTCCCTGAGGAGG - Intronic
926880097 2:17536044-17536066 TTAGTTGGTTGTCTCTGAGGGGG + Intergenic
927887181 2:26725720-26725742 TTACTGGCCCGACGCTGTGGAGG + Intronic
930509501 2:52326775-52326797 TTTGTGGCTTCACTCTGAGCAGG - Intergenic
931509872 2:62979808-62979830 TTAGTCTCCTCACTCTGAGAGGG + Intronic
931797287 2:65723347-65723369 TTACTGTCCTGCATCTGAGGTGG + Intergenic
932048375 2:68373359-68373381 TCCGGGGTCTGACTCTGAGGAGG - Intronic
937638669 2:124187002-124187024 TTTGGGGCCTGACACTTAGGAGG + Intronic
938635716 2:133223996-133224018 TTAGTGGCCTGACTTTCTGAAGG + Intronic
939187540 2:138878446-138878468 TGCCTGGCCTGACTCTTAGGGGG + Intergenic
941542745 2:166806874-166806896 GTAGTGGACTGACTTTAAGGAGG - Intergenic
942713494 2:178864709-178864731 ATGGTGGCCTGGCTCTGAAGTGG - Intronic
946763742 2:223021003-223021025 TTAGTGGCCTGATTCTCTGTGGG - Intergenic
1169130108 20:3162346-3162368 TTAGTGTCCAGATTCTGAGCTGG + Intergenic
1173233802 20:41225347-41225369 TCAGTGGCCAGCCTCTGAGTGGG - Intronic
1177410050 21:20718214-20718236 TCAGTGGCCTTGCTTTGAGGTGG + Intergenic
1178403373 21:32305960-32305982 TTTGTGGCCTGAGGCTGAAGGGG - Intronic
1179021797 21:37647600-37647622 TTTGAGGCCTAACTCTGGGGGGG - Intronic
1180600039 22:17009629-17009651 GTAGTGACCCGACCCTGAGGTGG + Intergenic
1180842570 22:18966131-18966153 TTGGTGGCCTCTCTCTGGGGAGG - Intergenic
1181058909 22:20272725-20272747 TTGGTGGCCTCTCTCTGGGGAGG + Intronic
1182451863 22:30426527-30426549 TCAGTGGCCCGAGTCCGAGGTGG + Intronic
949108729 3:232152-232174 TTACTGACCTCACTGTGAGGAGG + Intronic
949440243 3:4072195-4072217 TAAGTGGCCTGACTGTCAGAAGG + Intronic
951400899 3:22230444-22230466 TTAGTTCCCCGATTCTGAGGGGG + Intronic
952194305 3:31056866-31056888 AGAGGGGCCTGACTGTGAGGAGG - Intergenic
955792437 3:62602518-62602540 CTTGTGGCCTGCCTTTGAGGTGG + Intronic
956311664 3:67887747-67887769 TTTGTGTCCTGACACTGAGAAGG - Intergenic
959162172 3:102736524-102736546 TGCGTGGCCTGATCCTGAGGAGG + Intergenic
959666845 3:108932232-108932254 TTATTGGCCTGAGCCTGAGTGGG + Intronic
959689998 3:109188679-109188701 TAAGTGGGATGACTCTGGGGAGG - Intergenic
967819143 3:193825347-193825369 TCATTGGCCTGACTCTTAAGAGG - Intergenic
968575490 4:1364241-1364263 TGTGTGGCCTGGCTCTGTGGGGG + Intronic
969648251 4:8446676-8446698 TTAAGGTCCTGTCTCTGAGGTGG + Intronic
975381071 4:73701233-73701255 TTAGTGTCATCACTCTGAAGGGG - Intergenic
985105195 4:186492784-186492806 TTAGTGGCCTGACTCTGAGGAGG + Intronic
990654189 5:57936166-57936188 TGAGTGTCAGGACTCTGAGGGGG - Intergenic
991994547 5:72374430-72374452 TTGGTGGCCAGTCTCCGAGGTGG + Intergenic
993745869 5:91596254-91596276 TTAGTGGCTTGAGTCTTTGGTGG - Intergenic
995398597 5:111716429-111716451 ATAGGGGCCTGACTATGAGAAGG - Intronic
996014447 5:118517288-118517310 TTAGTGCCCTCACTCTGGTGAGG - Intergenic
996046810 5:118882970-118882992 TTTGCGGCCTGACCATGAGGTGG - Intronic
996294108 5:121890924-121890946 GAAGTGGCCTGACTTTGGGGAGG - Intergenic
996859174 5:128044813-128044835 TGAGGGGCCTGACTCTTAGAAGG + Intergenic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
999314788 5:150576456-150576478 TCAGGGGCCTGTCTGTGAGGAGG + Intergenic
999428105 5:151504837-151504859 CCAGTGGTGTGACTCTGAGGTGG + Exonic
1000128533 5:158271846-158271868 TGAGTGCCCTGACTTGGAGGTGG + Intergenic
1002446931 5:179295658-179295680 TTTGTGTCCTGAGTCTGTGGTGG - Intronic
1004774172 6:18823739-18823761 TTAGTGGCCAGAATCAGAGAAGG + Intergenic
1005288027 6:24349901-24349923 ATGGTGCCCTGACTCTGAGGTGG + Intronic
1006982157 6:38155291-38155313 TTGGTGGCCTGGGTGTGAGGCGG + Intergenic
1012796441 6:103768555-103768577 TTAGAGGCCCGTGTCTGAGGGGG - Intergenic
1014124363 6:117759752-117759774 ATAGTGGCCAGACTCTTATGTGG + Intergenic
1014543198 6:122700801-122700823 TTAGTGGCCTTTCTCAGAAGTGG + Intronic
1016761620 6:147744029-147744051 TTAGTTACGTGACTCTGAGCAGG - Intergenic
1018336329 6:162793838-162793860 CTTGTGTTCTGACTCTGAGGAGG + Intronic
1021632114 7:22657733-22657755 TTAGAGACCAGACTCTGATGTGG - Intergenic
1021710454 7:23411027-23411049 TCAGTGGCCTGACTTTGAGCAGG - Intronic
1026903739 7:74051127-74051149 CTAGTGGTCTGACCCTGAGGTGG - Intronic
1032773848 7:135090034-135090056 GCACTGGCCTGACTCTGGGGAGG + Intronic
1033508855 7:142034370-142034392 ATAGTGGCCTTACTCTGCTGTGG - Exonic
1040398863 8:47027272-47027294 TTACTGGCCTGACTCCCAGCAGG + Intergenic
1041402043 8:57456527-57456549 TAAGTGGCCCGACTCTCAGCTGG + Intergenic
1046454600 8:114441219-114441241 TTTCTGAACTGACTCTGAGGAGG - Intergenic
1049437429 8:142594253-142594275 TGCCTGGCCTGGCTCTGAGGAGG + Intergenic
1052705668 9:31990594-31990616 TGAGGGACCTGACTCTTAGGAGG + Intergenic
1052999732 9:34571361-34571383 GCAGTGGCCTGGCACTGAGGCGG - Intronic
1053539188 9:38955982-38956004 TCAGAGGCCTGACACTCAGGAGG + Intergenic
1054626953 9:67407937-67407959 TCAGAGGCCTGACACTCAGGAGG - Intergenic
1057546508 9:96022912-96022934 TAAGTGGCCTGTGTCTGTGGGGG - Intergenic
1058556669 9:106176005-106176027 TTTGTGACCTTATTCTGAGGTGG - Intergenic
1061713654 9:132505092-132505114 TTAGTGGATTCAGTCTGAGGTGG - Intronic
1062183371 9:135203053-135203075 TACGTGGCCTGACTCTCCGGAGG + Intergenic
1203745446 Un_GL000218v1:38540-38562 TGGGTGGCCTGGCTCTGAGCGGG + Intergenic
1203564664 Un_KI270744v1:80944-80966 TGGGTGGCCTGGCTCTGAGCGGG - Intergenic
1189297852 X:39931265-39931287 CTAGTGGCCTGGCTTTGGGGTGG - Intergenic
1191667689 X:63720185-63720207 TTTGTAGCTTGACTCTGAGCTGG - Intronic
1194085660 X:89524766-89524788 TGTGTGTCCTAACTCTGAGGGGG + Intergenic
1196967638 X:121076142-121076164 TTAGGAGCCAGACTCTGAGGTGG + Intergenic
1199369850 X:147034967-147034989 TTTCTGGGCTGACCCTGAGGAGG + Intergenic
1202169115 Y:22022091-22022113 TTGGTGTTCTGCCTCTGAGGTGG + Intergenic
1202222246 Y:22564277-22564299 TTGGTGTTCTGCCTCTGAGGTGG - Intergenic
1202305871 Y:23469804-23469826 TTGGTGGACTGAGTCAGAGGAGG + Intergenic
1202320869 Y:23631384-23631406 TTGGTGTTCTGCCTCTGAGGTGG + Intergenic
1202549898 Y:26038672-26038694 TTGGTGTTCTGCCTCTGAGGTGG - Intergenic
1202564938 Y:26200785-26200807 TTGGTGGACTGAGTCAGAGGAGG - Intergenic