ID: 985107104

View in Genome Browser
Species Human (GRCh38)
Location 4:186510195-186510217
Sequence AGCAGGGATGTTCCTTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985107104 Original CRISPR AGCAGGGATGTTCCTTCTCA TGG (reversed) Intronic
901671392 1:10858247-10858269 AGCTTGGCTGTTCCTTCTAAGGG - Intergenic
901898690 1:12339064-12339086 AACAGGGATGTTAATACTCAGGG + Intronic
902796607 1:18804550-18804572 AGAAGGGAGGTACCTTCACAAGG + Intergenic
904821110 1:33245095-33245117 AGCAGGGCTTCTCCTTCGCAGGG + Intergenic
906049814 1:42860933-42860955 AGAGGGGATGTTACTTCTCTGGG - Intergenic
906676003 1:47694199-47694221 AGCTTGGATGCTCCTCCTCATGG + Intergenic
907835556 1:58105326-58105348 AGCAAGGAAGGTCCTTCTAATGG - Intronic
907931137 1:59001731-59001753 AGTAGGGATCTTCCTTAACATGG + Intergenic
907942039 1:59097413-59097435 ATAGGTGATGTTCCTTCTCAGGG + Intergenic
911098205 1:94073030-94073052 AGCAAGGATGTTGCTTCACTGGG - Intronic
913333139 1:117683808-117683830 GGCAGGGATGTTCCCACACAGGG - Intergenic
914334912 1:146705244-146705266 ATAAGTGATATTCCTTCTCAAGG - Intergenic
915545454 1:156594660-156594682 AGCAGGAATGCTCCTTCAAAGGG + Intronic
916034769 1:160912065-160912087 GGCAGAGCTGTTTCTTCTCAGGG + Intergenic
916606392 1:166346657-166346679 AGCAGGAATCTTCCTTATGATGG + Intergenic
918377335 1:183922353-183922375 GACAGGCATGTTCCTTCCCAGGG + Intronic
918434615 1:184498709-184498731 AACAGTGATGTTCTTTTTCAGGG - Intronic
918679171 1:187329860-187329882 AGCAGGGCAGTGCCTTCTCATGG + Intergenic
920165243 1:204031224-204031246 AGCAAGGATGTTGCATCTCCTGG - Intergenic
920537330 1:206746820-206746842 TGCAGGCATGTTTCTTCTGAAGG + Intergenic
920665704 1:207961374-207961396 AGCAGGACTGTTCCTTCTGGAGG + Intergenic
920721069 1:208387451-208387473 AGAAGGGATGATCCTCCTCTTGG + Intergenic
921268256 1:213444038-213444060 AGCAGGGTGGTTCCTTCTGAGGG + Intergenic
921602114 1:217117168-217117190 AGAAGGGATGTGGCTTTTCAAGG - Intronic
922174659 1:223188025-223188047 ATCAAGGCTGTTTCTTCTCATGG - Intergenic
922175761 1:223195840-223195862 AGCAGGATTGTTCCTCCTGAGGG + Intergenic
1063699603 10:8371668-8371690 GGCAATCATGTTCCTTCTCACGG - Intergenic
1065733375 10:28729630-28729652 AACAGAGATGTTCCTTCTTAGGG - Intergenic
1067899582 10:50225031-50225053 AGAAGTGATGTACGTTCTCAAGG + Intronic
1070140475 10:73734208-73734230 CCCAGAGCTGTTCCTTCTCAAGG + Intergenic
1072051909 10:91713083-91713105 AGCAGGGCTGTTCCTTTTGGAGG - Intergenic
1073566510 10:104539978-104540000 ATCAGGGATGAGCCTTGTCAAGG - Intergenic
1074418172 10:113285447-113285469 AGCAGGGATGTTCCCAAGCAGGG - Intergenic
1074426197 10:113353667-113353689 GGCAGGGTGGTTCCTTCTGAGGG - Intergenic
1079326122 11:19494128-19494150 AGAAGGTCTGTTCCTTCTCCAGG - Intronic
1080228412 11:29987101-29987123 AGCAGGGCTATTCCTTCTGGAGG - Intergenic
1080521183 11:33068881-33068903 AGCAGGGATGTGCCCTCTGAGGG + Intronic
1084450255 11:69232630-69232652 AGCAGGGTGGTTCCTTCTGGAGG - Intergenic
1084580970 11:70023061-70023083 AGCAGGGCTGTTCCTTCTGGAGG - Intergenic
1085586204 11:77709077-77709099 AGCAGGGTTGTGCCACCTCAGGG + Intronic
1085668069 11:78433896-78433918 AGGAGGAAAGGTCCTTCTCAAGG - Intergenic
1087254788 11:95941314-95941336 AACATGGTTCTTCCTTCTCAAGG + Intergenic
1088664887 11:112084762-112084784 AGCAGGCTTGTTCTTTCGCAAGG + Exonic
1090141738 11:124272360-124272382 AGCAGGTATGTTCCTTAGCTTGG + Intergenic
1090991873 11:131825054-131825076 GGCAGGGTGGTTCCTTCTGAGGG + Intronic
1091205940 11:133821156-133821178 AGCAGGGGTGCTCCTGCCCAGGG - Intergenic
1091249337 11:134129086-134129108 ACCAGGGATGTGCCTGCACAGGG - Intronic
1091337810 11:134785738-134785760 AGCTGGGTTTTTCCTTCTGAAGG + Intergenic
1095714998 12:45334483-45334505 AGAAGGAATGCCCCTTCTCAGGG + Intronic
1095909396 12:47410560-47410582 GGCTGGCATTTTCCTTCTCATGG - Intergenic
1096222007 12:49836105-49836127 GGCAGGGCTGTTCCTTCTGGAGG + Exonic
1098106544 12:67073550-67073572 AGCTGGGATTTTACTTCTCCTGG - Intergenic
1098571336 12:71990786-71990808 TGAAGGGAAGTTCTTTCTCAGGG + Intronic
1098811072 12:75093423-75093445 AGGAGGGATGTTGCATCTCAGGG - Intronic
1099945890 12:89244003-89244025 AGGAAGGATGTTCCTTTTCTGGG - Intergenic
1101741101 12:107500650-107500672 ACCAGGGGTCTTCCATCTCATGG + Intronic
1102332494 12:112046240-112046262 AGGTGGAATGTTCCTGCTCAGGG - Intronic
1103881791 12:124171991-124172013 AGCAGGGCTGCTCCTTCTGGAGG + Intronic
1107651144 13:42546496-42546518 AGCAGGGAAGTTTCATCTGAGGG - Intergenic
1113733556 13:112659240-112659262 GGCAGGGATGATCCTCCCCAGGG + Intronic
1114268860 14:21089369-21089391 GGCAGAGATGATTCTTCTCAGGG - Exonic
1117722208 14:58638569-58638591 AGCACGGCTGTTCCTGCCCAGGG + Intronic
1119229803 14:72970940-72970962 CGCCGGGCTGTTCCTTCTCGTGG - Exonic
1119308776 14:73629442-73629464 ACCAGGCATGTTTCTTCTCTTGG - Intergenic
1120145073 14:80970470-80970492 AGCAAGGATCTGCCTTCTGAAGG - Intronic
1120185104 14:81386109-81386131 AGCAGAGCCTTTCCTTCTCAGGG - Intronic
1121036344 14:90707059-90707081 AGCAAGAATATTCATTCTCAAGG + Intronic
1121514518 14:94540570-94540592 GGCAGGGATGTTCCTTCAGTGGG - Intergenic
1122071718 14:99209422-99209444 ACCAGGCTTGTTCCTTCACATGG - Intronic
1122330629 14:100909984-100910006 CACAGGGATGTTAATTCTCATGG + Intergenic
1122336920 14:100997174-100997196 ATCAGGAATGTTCCTTCTTTTGG + Intergenic
1123954995 15:25325958-25325980 AGCAGGCATGTTCTTTCCCTAGG + Intergenic
1126805661 15:52346069-52346091 AGCAGGTAGTTTTCTTCTCAAGG + Intronic
1126960147 15:53983681-53983703 ATCAGGAATGTTCCCACTCAAGG - Intergenic
1127716551 15:61654389-61654411 AGCAGGGACCTACCTTCTCTAGG + Intergenic
1132255287 15:100371765-100371787 AGAACGGATGTTCCTTTTTATGG + Intergenic
1132572700 16:650964-650986 AGCAGGGTTGTTCCAGGTCAAGG - Intronic
1132711849 16:1272364-1272386 AGCAGGGATGTTGTCTCTCCCGG - Intergenic
1132715478 16:1288089-1288111 AGCAGGAATGTACTATCTCACGG - Intergenic
1132738784 16:1400557-1400579 AGCAGGGGGGTTCCTTCTGCAGG + Intronic
1133650225 16:7805831-7805853 AGCAGGCATGGTCTTTCTCTTGG - Intergenic
1135122017 16:19774354-19774376 AGCAGGTATGTTCCAGCTAAAGG + Intronic
1135221230 16:20615399-20615421 AGCAGTGCTGTTTCTTTTCAGGG - Intronic
1136929482 16:34406436-34406458 CGCAGGGCTGGTCCTTCTGAGGG - Intergenic
1136975092 16:35005368-35005390 CGCAGGGCTGGTCCTTCTGAGGG + Intergenic
1139998711 16:71005992-71006014 ATAAGTGATATTCCTTCTCAAGG + Intronic
1140318835 16:73927974-73927996 GGCAGGTTTGTTACTTCTCAGGG - Intergenic
1141023876 16:80525171-80525193 AGCTGAGGTGTTTCTTCTCATGG - Intergenic
1142301800 16:89262946-89262968 AGCAGGGATGGCAGTTCTCAAGG + Intergenic
1143990268 17:10953216-10953238 AGCAGAGTTGGTCCTTCTGAGGG + Intergenic
1144119934 17:12142456-12142478 AGCAGGGATGTTCCTTACCAAGG + Exonic
1147119410 17:38327091-38327113 AGGAGAGATGTTCCTTCAGAAGG - Exonic
1151531292 17:74706803-74706825 AGGAGGGCTGTGCCTTCGCATGG - Intronic
1152048188 17:77952715-77952737 AGCAGGGCTGGTTCTTCTAAAGG + Intergenic
1153046835 18:863667-863689 AGCAGGGTTGTTTGCTCTCATGG + Intergenic
1153935607 18:9918093-9918115 AGCAGGGTTTTTCTTTCTCAGGG - Intronic
1156929494 18:42624709-42624731 AGCAGTGCAGTTCCTTCTGAGGG - Intergenic
1157574410 18:48733938-48733960 AGCAGGGGTCTTCATTCTCAAGG + Intronic
1157869642 18:51218291-51218313 AGCTGGGTTGTTCCTGCTGATGG + Intronic
1158241273 18:55380698-55380720 AGCAGGGATGCTCATTCGCATGG + Intronic
1158445020 18:57511978-57512000 AGCAAGGATGCCCCTTCTCATGG + Intergenic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1158533418 18:58284059-58284081 GGCAGGGTGGTTCCTTCTGAAGG - Intronic
1160986600 19:1841844-1841866 GGCAGGGACGGTGCTTCTCAGGG + Intronic
1161567891 19:5013520-5013542 GGCAGGGCTGTTCCTTCTGGAGG + Intronic
1163137774 19:15325111-15325133 AGCAGTGCTGTGCCCTCTCAAGG - Intronic
1167209371 19:48123440-48123462 ATCAGGGTTCTTCCCTCTCAAGG - Intronic
925009990 2:476651-476673 AGCAGGCATGGTCCTTCTGCAGG - Intergenic
925869073 2:8253616-8253638 AGCAGGCCAGTTCCTTCTGAGGG + Intergenic
926284654 2:11478974-11478996 AGTAGGTTGGTTCCTTCTCATGG - Intergenic
927479709 2:23442578-23442600 GGCAGGGATGTTCCTTCTGGAGG - Intronic
930625611 2:53694263-53694285 AGTAGGAACTTTCCTTCTCATGG + Intronic
932999491 2:76904104-76904126 AGGAGAGAAGTTACTTCTCAGGG + Intronic
933143574 2:78823477-78823499 ACCTGTGATGCTCCTTCTCAGGG - Intergenic
934169676 2:89330078-89330100 AGCAGGGAGGTTTCTGTTCAGGG + Intergenic
934197616 2:89852507-89852529 AGCAGGGAGGTTTCTGTTCAGGG - Intergenic
934303817 2:91803601-91803623 AGCAGGGATGGTCCCTTCCAGGG - Intergenic
934329437 2:92049150-92049172 AGCAGGGATGGTCCCTTCCAGGG + Intergenic
934467659 2:94279067-94279089 AGCAGGGATGGTCCCTTCCAGGG + Intergenic
935603378 2:104945535-104945557 AGCAGTGATCTTCCTTCTAGAGG - Intergenic
938191288 2:129283251-129283273 TGCAGGTATGTTCCTTTGCAAGG - Intergenic
940222173 2:151363895-151363917 AGCACTGTTGTTCCTTCTTACGG - Intronic
941402875 2:165053154-165053176 AGCAGGGATGTTCAATCTTTTGG + Intergenic
945923751 2:215782691-215782713 TGCAGGGAAGTTTCTTCTGAGGG + Intergenic
948973112 2:241444594-241444616 AGCTGGAATGTTCCTTCCTAAGG + Intronic
1168870177 20:1120757-1120779 AGCAGAGCTGTTCCATCTGAAGG - Intronic
1169083014 20:2808908-2808930 ATCAGGAATATTCCTTCCCAGGG - Intergenic
1169240564 20:3975849-3975871 AGCAAGGTTGTTCCTTCTGAGGG - Intronic
1169595306 20:7191723-7191745 AGCAGAGCTGTTCCTCCTAAGGG + Intergenic
1169826301 20:9772426-9772448 AGCGGGGATATTCCTTCACAGGG - Intronic
1169911088 20:10647947-10647969 AGAAGGGAGGTACCTTCACAGGG + Exonic
1170998169 20:21386028-21386050 AGCAAGGATATACCTTCTAAAGG - Intronic
1171895419 20:30754537-30754559 AGCAGGTCTGATCCTTCTCCTGG - Intergenic
1174215421 20:48912540-48912562 AGCTGGGATGTTCATTCGCCAGG - Intergenic
1175290484 20:57871890-57871912 AGTCTGGCTGTTCCTTCTCAAGG + Intergenic
1175299755 20:57934502-57934524 AGCAGGGATGGTGCTTCCCCGGG - Intergenic
1177361083 21:20072377-20072399 AGCTAGTATATTCCTTCTCAAGG + Intergenic
1181778274 22:25175360-25175382 AGCAGCGGTGTTCCTCCTCTGGG - Intronic
1182972881 22:34594031-34594053 ATCAGGGAAAGTCCTTCTCATGG + Intergenic
1183338294 22:37263655-37263677 AGCAGGGTTGTTTCTTCTGAGGG - Intergenic
1183447215 22:37865669-37865691 AGCAGGAAGCCTCCTTCTCAAGG - Intronic
1183686470 22:39363827-39363849 CTCAGGGATGTTCCTGCGCAGGG + Intronic
1184009442 22:41735972-41735994 AACAGGTATTTACCTTCTCATGG + Intronic
1184781600 22:46652373-46652395 GGCAGGGCTGTTCCTTCTGCAGG - Intronic
950493003 3:13317610-13317632 AGCAGGGATGTTCCATCTTGGGG + Exonic
950686851 3:14624708-14624730 AGCATGAATGTCACTTCTCAGGG - Intergenic
951327274 3:21318224-21318246 AGCTAGCATGATCCTTCTCAGGG + Intergenic
955520440 3:59770575-59770597 AGCAGAGCTGTTCCTCCTGAGGG - Intronic
960932412 3:122866870-122866892 ACCAAGGCTGTTGCTTCTCATGG + Intronic
961027910 3:123576811-123576833 AGAAGGGATCTTTCTTCTTAAGG + Intronic
961121317 3:124373537-124373559 AGCAGGGTTGTTCCTTCTGAGGG + Intronic
961243884 3:125435117-125435139 AGCAGGGTGGTTTCTCCTCAGGG + Intergenic
962537531 3:136343548-136343570 GGCAGGTCTGTTTCTTCTCAGGG - Intronic
964546776 3:157842957-157842979 ACCAGGAAAGTTCCTTCTCTTGG - Intergenic
965577706 3:170234905-170234927 AGGTGGGAGGATCCTTCTCAGGG - Intronic
967996655 3:195172013-195172035 AAAAGGGATGTTCCTTTTCCAGG + Intronic
970151417 4:13094581-13094603 AGCTGGGAAGTTCCATATCAAGG + Intergenic
972104569 4:35465873-35465895 AGCAGGGATGTTCAATCTTCTGG - Intergenic
972450465 4:39192908-39192930 AGCTGGGCTGTGCTTTCTCATGG - Intronic
973073498 4:45894797-45894819 AGCAGGGATCTCCCTGTTCAGGG - Intergenic
977554768 4:98477458-98477480 AGTGGGGATGCTCCTTCTTATGG - Intronic
980707524 4:136519481-136519503 AGAAGGGATTTTCCTTGTCTCGG - Intergenic
981522164 4:145674415-145674437 ATCAGATACGTTCCTTCTCATGG - Intergenic
985107104 4:186510195-186510217 AGCAGGGATGTTCCTTCTCATGG - Intronic
985569002 5:633683-633705 TGCAGGAATTTTCCTTCTCCTGG + Intronic
985607283 5:864767-864789 AGCACGGATGCTGCTTCTGAAGG + Intronic
986757949 5:10855391-10855413 AGCAGGGAGGATCCTTCCCTGGG + Intergenic
987277572 5:16377852-16377874 AGAAGGGCTTTTCCTTCTCTTGG - Intergenic
994865072 5:105258185-105258207 ATCAGGCATGATCCTTCTCTTGG + Intergenic
995021622 5:107373167-107373189 AGCCAGCATGTTCCTTCTCTTGG - Intergenic
995389424 5:111624082-111624104 ATCAGCTATGTTCCTTCTCTTGG + Intergenic
996241987 5:121215408-121215430 AGCAGAAATGTTCTTACTCAGGG - Intergenic
996284439 5:121771611-121771633 AGCAGGGCTGTACTTTCTCTAGG - Intergenic
996353044 5:122566728-122566750 GGCAGGGATATGCCTTCTGAGGG - Intergenic
999636970 5:153633111-153633133 GGCAGGGAGGCTCCTGCTCATGG + Intronic
999857320 5:155608872-155608894 ATCATACATGTTCCTTCTCAGGG - Intergenic
1001584459 5:172823970-172823992 AGCAGGGATGCTCCTGCCCCTGG - Intergenic
1004120188 6:12814045-12814067 AGGAGGGATGTGTCTTCACAGGG - Intronic
1004206321 6:13594695-13594717 AGCAGGGATGGTGCTCCCCAAGG + Intronic
1012720820 6:102741729-102741751 AGAAGAGATGTTCTCTCTCATGG - Intergenic
1017076684 6:150625305-150625327 AGCAGGGTTGTTTCTTCGCAGGG + Intronic
1017753183 6:157507794-157507816 AGGAAGGATGTTCCTTGCCAAGG - Intronic
1024233346 7:47379247-47379269 AGCCAAGAGGTTCCTTCTCAAGG + Intronic
1024286492 7:47762392-47762414 GGCAGTGTTGTTCCTTCTAAAGG - Intronic
1026509313 7:71015447-71015469 AGCAGGACTGTTCCATCCCAAGG - Intergenic
1026989624 7:74576568-74576590 AGCAGGGCTGATCCTTCTGGAGG + Intronic
1029454230 7:100659821-100659843 AGCAGTGAATTTTCTTCTCATGG + Intergenic
1029778723 7:102708528-102708550 AGCATTGTTGTTCCTGCTCAAGG - Intergenic
1031753859 7:125612962-125612984 AGCAGGGGAGTCCCTTCCCATGG - Intergenic
1032094803 7:128932659-128932681 AGCCGGGATATGCCTCCTCATGG + Intergenic
1033082452 7:138311111-138311133 AGCAGAGAGGTTTCTTCTTACGG - Intergenic
1033766038 7:144491553-144491575 AGCAGAGATGTGCCTCGTCAGGG - Intronic
1034654393 7:152717783-152717805 AGCAAGGATTTTGGTTCTCAAGG + Intergenic
1034908700 7:154973931-154973953 AGCTGGGCTGTTCCATCTGATGG - Intronic
1038147022 8:24906588-24906610 AGCATAGATGTTTCTTTTCAAGG + Intergenic
1038992165 8:32879557-32879579 AGCAGAGATGTTCCTACAAAGGG - Intergenic
1039581675 8:38671871-38671893 AGCCAGGATGTGGCTTCTCAGGG + Intergenic
1040822952 8:51585341-51585363 AGCAGATATGTTCCACCTCAGGG + Intronic
1041114784 8:54525009-54525031 AGAAGGGCAGATCCTTCTCAGGG - Intergenic
1041134494 8:54742804-54742826 AGCATGGATGTGCTTTCTCTGGG + Intergenic
1041774856 8:61512500-61512522 GGCAGGGTTGTTCCTTCTGGAGG - Intronic
1042604041 8:70528364-70528386 AGCAGGGAAGCTCCTGCCCATGG + Intergenic
1042695412 8:71548790-71548812 ATCTGAGATGTTCCTTCTCCAGG + Intronic
1044104780 8:88190402-88190424 AGCAGGCAGGTTCTTTCTTATGG + Intronic
1044839957 8:96329112-96329134 AGCATGGAGGGACCTTCTCAAGG - Intronic
1046493224 8:114980840-114980862 AGCACAGATGTGCATTCTCAGGG - Intergenic
1047208882 8:122824825-122824847 GGCAGGGCTGTTCCTTCTGGAGG + Intronic
1049914788 9:306874-306896 AGCTGGGCAGTACCTTCTCAGGG - Intronic
1051121895 9:13760693-13760715 GGCAGGTAAGTTCCTTCTGAGGG - Intergenic
1054947573 9:70812106-70812128 AGCAGAGCTGTTCATACTCATGG - Intronic
1055100259 9:72456822-72456844 AGCAGTGATGCTCCTCCTCAGGG + Intergenic
1056305811 9:85289365-85289387 AGCAGGGGTGGTGCTTGTCACGG - Intergenic
1056545805 9:87612465-87612487 GGTAGGGATGGTCCTTCTAAGGG - Intronic
1057186077 9:93058343-93058365 AGCAGGATTTTGCCTTCTCAGGG - Intergenic
1058622277 9:106896161-106896183 ATAAGGCATGTTCTTTCTCATGG - Intronic
1060874232 9:127068729-127068751 AGCAGAGATGTTGCTTCTTGTGG + Intronic
1061475805 9:130865371-130865393 TGCAGGGATGTTTCTGCGCACGG - Intronic
1186442547 X:9598735-9598757 AGCAGGGCTCTTCCTCCTGAGGG + Intronic
1187472099 X:19578779-19578801 AGGAGGGATGTTACTGCTCATGG + Intronic
1188059662 X:25585440-25585462 AGCAGGGCTGTTTCTTCTGGAGG - Intergenic
1189232817 X:39465574-39465596 AGCAGGGATGTGCGTTGTCAGGG + Intergenic
1189553452 X:42116849-42116871 AGCAGAGATGTTGCTGCTCAGGG + Intergenic
1190066570 X:47245462-47245484 ACCAGGGGTTTTCCTTCTCCAGG - Exonic
1192705346 X:73523740-73523762 ACCAGGGATGTTTCTTACCAAGG - Intergenic
1193221142 X:78928500-78928522 AGAAGGGATTTTCCTTTTCGTGG - Intergenic
1196754826 X:119148957-119148979 AGCAGGGTTGCACTTTCTCAAGG - Intronic
1198068165 X:133120540-133120562 GGCAGGGAAGTTCATTCTCTTGG + Intergenic
1198646793 X:138816857-138816879 AGCAGGGATGTCCCATCTTTTGG - Intronic
1198703044 X:139417728-139417750 AGCAGGTTGGTTCCTTCTGAGGG - Intergenic
1199793722 X:151177007-151177029 AGCAGGGATGTTCAATATGAGGG - Intronic