ID: 985108529

View in Genome Browser
Species Human (GRCh38)
Location 4:186522916-186522938
Sequence CAGGAAAAAGACTGGGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 376}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985108524_985108529 2 Left 985108524 4:186522891-186522913 CCGTTTTTTTTCTCTCATTTGTA 0: 1
1: 2
2: 13
3: 205
4: 2214
Right 985108529 4:186522916-186522938 CAGGAAAAAGACTGGGTAGGTGG 0: 1
1: 0
2: 1
3: 39
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985108529 Original CRISPR CAGGAAAAAGACTGGGTAGG TGG Intronic
900667343 1:3824468-3824490 CATGAAAAAGACTGGCAAGGTGG + Intronic
902753089 1:18531069-18531091 CAGGAAAGAGACTGGATGAGTGG - Intergenic
902933125 1:19745277-19745299 CAGGTAAAAGGGTGGGTGGGTGG + Intronic
903164784 1:21512548-21512570 CAGGGAAAACACTGGTTTGGGGG + Intronic
905284112 1:36868182-36868204 GAGGAGCAAGACTGGGAAGGTGG - Intronic
905649324 1:39646088-39646110 AAGGAAAAAGACTGGGCAGTTGG - Intergenic
906918925 1:50042378-50042400 CATGTAAAAGTCTGGGTATGTGG + Intergenic
907946619 1:59141475-59141497 CAGGAACAAGGCTGGGTACAGGG - Intergenic
908305365 1:62808691-62808713 CAGGAAATAGCCTGAGTAGAGGG + Intronic
908376460 1:63547042-63547064 AGGGAAAAAGAATGGGGAGGTGG - Intronic
910121316 1:83793354-83793376 CACCAAAAAGTCTGGGGAGGGGG + Intergenic
912850739 1:113121747-113121769 AAAAAAAAAGACAGGGTAGGAGG + Intronic
914687902 1:149998204-149998226 CAGGAAAAAGACTGTCTACAAGG - Intronic
914942463 1:152035282-152035304 CAGGAAGGAGACTGGCTGGGAGG + Intronic
917101201 1:171447305-171447327 AAGCAAAGAGACTGGTTAGGAGG - Intergenic
917773900 1:178312509-178312531 CAGGAAAAATGATGTGTAGGAGG - Intronic
919896465 1:202012513-202012535 GAGGAAGAAGTCTGGGGAGGGGG - Intronic
920001596 1:202803874-202803896 CAGGAGAAAAACCTGGTAGGAGG - Intronic
920527812 1:206681051-206681073 CATATAAAAGTCTGGGTAGGTGG + Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
922157154 1:223049448-223049470 CAGGAAAGACACTGTGAAGGAGG + Intergenic
922461668 1:225818093-225818115 CAGGAAGAGGGCTGAGTAGGTGG - Intronic
923013826 1:230110240-230110262 CAGGAAAAACACAGGTGAGGAGG - Intronic
923837489 1:237628882-237628904 TTGGAAAAAGAAGGGGTAGGGGG + Intronic
924725185 1:246663107-246663129 CAGGAGGAAGACTTGGGAGGAGG - Intronic
1063643387 10:7854557-7854579 CTGGAAGAAGCCTGGGGAGGAGG + Intronic
1063837052 10:10027578-10027600 CATGAAAAAGCCTGGGAAGTAGG - Intergenic
1064261883 10:13792677-13792699 AAGGATAAAGACTGGAGAGGCGG - Intronic
1064355492 10:14614171-14614193 CAGGACAACGACTGTTTAGGGGG - Intronic
1066635706 10:37496878-37496900 CAGGAAAGAGAGTGAGAAGGGGG - Intergenic
1066670345 10:37830556-37830578 CAGGAAATAGAAGGGGTATGTGG + Exonic
1066706329 10:38183042-38183064 CAGGGAAAAGGGTGGGAAGGGGG - Intergenic
1067267495 10:44758128-44758150 AAGAAAAAGGACTGGGCAGGGGG - Intergenic
1067831851 10:49615055-49615077 GAGGAAGAAGAGTTGGTAGGTGG + Intronic
1069563211 10:69445988-69446010 GAGGAGGAAGACTGGTTAGGAGG - Intergenic
1069777350 10:70934793-70934815 CAGGAAAGAGGCTGGGAAGGCGG - Intergenic
1071816345 10:89235574-89235596 GAGGAAGATGACCGGGTAGGTGG + Intronic
1072197802 10:93131579-93131601 CAGGGAAACGCCTGGGCAGGTGG - Intergenic
1072280842 10:93863854-93863876 CAGGATAAAGAATGGGAAGAAGG - Intergenic
1072552883 10:96492770-96492792 CAAGAGAAAGACTGGGAATGCGG + Intronic
1075596846 10:123738081-123738103 CAGGAGAAAGAGAGGGCAGGGGG - Intronic
1076219036 10:128718204-128718226 CAGGAACCAGACAGGGCAGGTGG - Intergenic
1076361678 10:129894072-129894094 CAGGAACAGGACTGGGGAGCAGG - Intronic
1076717066 10:132371577-132371599 CAGGAAAGACCCTGGGGAGGGGG - Intronic
1078241221 11:9532256-9532278 CAGGAAAAAGGCTGGTGTGGTGG + Intergenic
1078693578 11:13606618-13606640 AAGCAGAAAGACTAGGTAGGTGG - Intergenic
1079201148 11:18378519-18378541 CAGGAAAATGACTTGGGAAGAGG - Intergenic
1079819220 11:25104734-25104756 CAGGAGACAGACTGTGAAGGGGG + Intergenic
1079864362 11:25716536-25716558 GAGCACAAAGACTGGGGAGGTGG + Intergenic
1079873227 11:25826208-25826230 CACCAAAATGCCTGGGTAGGAGG + Intergenic
1080264715 11:30388650-30388672 GAGGAAACAGACTGGGGAGGTGG - Intronic
1080587736 11:33696829-33696851 CAGGAGAAAGCCTGGGCTGGAGG - Intergenic
1080691992 11:34565966-34565988 GTGGACAAAGACTGGGTAGGAGG + Intergenic
1081504003 11:43695956-43695978 CAGGAAAAATAATGGGTACTAGG - Intronic
1082717445 11:56632023-56632045 CAGGAAGAAGAATGGGGAGATGG + Intergenic
1082783319 11:57302931-57302953 CTGGAAAAAGCATGGGAAGGAGG - Intronic
1083121163 11:60513060-60513082 GAGGAAGAAAAGTGGGTAGGAGG + Intergenic
1084500325 11:69531278-69531300 CAGCTCAAAGCCTGGGTAGGAGG + Intergenic
1084576106 11:69988958-69988980 AAGGAAATAGACAGGGAAGGAGG + Intergenic
1085385021 11:76152632-76152654 CAGGAAACACCCTGGGTAGGAGG - Intergenic
1087370462 11:97277503-97277525 CAGGAAAAACAGTGGGTACTAGG + Intergenic
1087400718 11:97663814-97663836 CAGGAATAAGTCTGATTAGGTGG + Intergenic
1087466191 11:98509711-98509733 CAGGGGAAAGAGTGGGAAGGAGG - Intergenic
1087755701 11:102052827-102052849 CTGGAAAAAGACTAGCTAGGAGG - Intronic
1088430310 11:109751602-109751624 CAGGAAAAAGAAAGAGTAAGGGG - Intergenic
1088818857 11:113440235-113440257 CTGGAAAAGAACTGGCTAGGTGG - Intronic
1089710620 11:120311872-120311894 CAGGAAAGAAACTGAGAAGGAGG + Intronic
1090175292 11:124643449-124643471 CAGGAAGAAGACCAGTTAGGAGG + Intronic
1090255803 11:125283289-125283311 CAGGGAAATGAATGGGTAAGTGG + Intronic
1090446244 11:126767193-126767215 TAGGAAAAGCACTGGGTTGGAGG - Intronic
1090678488 11:129027978-129028000 CAAGAAAAAGACTGATTAGGGGG + Intronic
1091554743 12:1564253-1564275 CAGGAAATGGACAGGGCAGGGGG + Intronic
1091930045 12:4388789-4388811 CAGGAAAAAGAGTGTGTTGGCGG - Intergenic
1092670409 12:10855074-10855096 CAGGAGAAGGACTGGGTGGGGGG - Intronic
1092829623 12:12431209-12431231 CATGAAAAATACTTTGTAGGTGG - Intronic
1093093725 12:14949197-14949219 GAGGAGAGAGACTGGGAAGGGGG - Intronic
1093119055 12:15245317-15245339 GAGGAAATTGGCTGGGTAGGTGG - Intronic
1093390225 12:18609869-18609891 CAGGAAAAAGACTAGGGAAAAGG + Intronic
1093709884 12:22318549-22318571 CAGGGAAAAGAGGGGGAAGGAGG - Intronic
1094533544 12:31300349-31300371 CAGGCAAAAGAGTGGGATGGGGG + Intronic
1096886319 12:54722702-54722724 AAGGAAAAAGAATGGGTACTTGG - Intergenic
1096903663 12:54912466-54912488 CAGGAAAGAGAGGGGGTAGTCGG + Intergenic
1096997155 12:55845679-55845701 AAGGAGAAAGACTGGAAAGGGGG - Intergenic
1097132212 12:56820340-56820362 CAGGAAAAAAAATAGGTAGCAGG + Intergenic
1097414001 12:59291724-59291746 CAGGAGAAAGAATGGTAAGGTGG + Intergenic
1099282168 12:80664373-80664395 CAGGAGAAAGACTGAGTATATGG - Intronic
1100102840 12:91130307-91130329 AAAGAAAAAGACAGGGTATGAGG - Intergenic
1100526788 12:95427069-95427091 CAGAAAAAAGACCAGGTATGAGG - Intergenic
1100633799 12:96414853-96414875 CAGGAACAAGATGCGGTAGGTGG + Intergenic
1100900666 12:99236979-99237001 CAGGAAAAATAATGGGTACTAGG + Intronic
1101241367 12:102842937-102842959 CAGGAGACAGACTGGGCAGAGGG - Intronic
1101862618 12:108495306-108495328 CAGGTCAAAGACTGGGGAGCTGG + Intergenic
1103019331 12:117521144-117521166 CAGAAAAAAGACTGTGATGGTGG - Intronic
1104527109 12:129534572-129534594 CAGGAAAGAGATTGGGTATGGGG - Intronic
1104973137 12:132540466-132540488 CAGGGACCAGAGTGGGTAGGTGG - Intronic
1105765165 13:23552138-23552160 AAGGGGAAAGAGTGGGTAGGAGG + Intergenic
1105869720 13:24493929-24493951 CAGGAAGAAAAGCGGGTAGGAGG - Intronic
1106355482 13:28978444-28978466 CAGGAAGAAGAATGAGAAGGGGG + Intronic
1108421902 13:50259327-50259349 GAGGAAACAGAGTGTGTAGGGGG - Intronic
1108464399 13:50700401-50700423 CATCAAAAAGACTGGGTCAGGGG + Intronic
1108940020 13:55941235-55941257 CAGGAAAAAGACCTGGGAAGGGG - Intergenic
1112235429 13:97631499-97631521 CAGGAAAAATATTTGGTAAGTGG - Intergenic
1112335090 13:98508079-98508101 CAGGAAGAATTCTGGGTAGCTGG - Intronic
1112419346 13:99233511-99233533 AAGGAAGATGAGTGGGTAGGTGG + Intronic
1112508134 13:99987747-99987769 CTGGAAAAAGACTTGGGTGGTGG + Intergenic
1112743096 13:102496680-102496702 CAGGAGAAAGAGTGTGAAGGGGG + Intergenic
1113463993 13:110501436-110501458 CAGGAGAAAGGCTGGGGTGGGGG + Intronic
1114573907 14:23695319-23695341 CTGGAAAAAGAGGGGGGAGGGGG + Intergenic
1115348246 14:32365677-32365699 CAGGAAAAAGATTGACCAGGAGG - Intronic
1115437546 14:33392783-33392805 AAGGAAAAATACTGTGTAGAGGG - Intronic
1115772972 14:36685936-36685958 CAGGGAAAAGATAGGGTGGGGGG - Intronic
1116080109 14:40161439-40161461 CATGAAAAAGACTCAGTGGGAGG + Intergenic
1116184360 14:41577811-41577833 CAGGAAAGAGACCTGGTAGGAGG + Intergenic
1116935770 14:50738494-50738516 TAGGAACAAGACTGGGAAGAGGG + Intronic
1117588384 14:57238465-57238487 TAGGATGAAGACAGGGTAGGGGG + Intronic
1117996033 14:61479175-61479197 GTGGAGAAAGACTGGGTGGGTGG - Intronic
1118101578 14:62610889-62610911 CAGGGAGAAGACTGGGAGGGTGG + Intergenic
1119758594 14:77135767-77135789 CAGGAACAAGCCTGGGTGGATGG + Intronic
1122619445 14:103046504-103046526 CAGGAAACAGACAAGGTAGGAGG + Intronic
1122757213 14:103991157-103991179 CAGGAACAAGGCTTGGTCGGGGG + Exonic
1124220537 15:27846758-27846780 CAGGGAAAGGAATGGGGAGGAGG + Intronic
1124285830 15:28399627-28399649 CAGGAAAGAGACGGGGGGGGGGG - Intergenic
1124590882 15:31051852-31051874 CTGGAAGAGGACTGGGTCGGAGG - Intronic
1124929072 15:34101562-34101584 CGGGAAAAAGGCTGGGATGGAGG - Intronic
1125995241 15:44153596-44153618 GATGAAAAAGACTGTGGAGGTGG + Intronic
1126473954 15:49046576-49046598 AAGGAAAAGGAGTGGGGAGGAGG + Intergenic
1127315166 15:57788204-57788226 CAGGAAATAGATGGGGCAGGTGG + Intergenic
1127619795 15:60722741-60722763 CAAGAAAAATACTGGAAAGGAGG + Intronic
1129466828 15:75728756-75728778 CAGCAAAGAGGCTGGGTGGGAGG + Intergenic
1131819657 15:96259215-96259237 CAGCAATAAGTCTGGGAAGGAGG + Intergenic
1132712563 16:1276109-1276131 CAGGAAGAAGACAGAGTAGTTGG + Intergenic
1132756072 16:1486141-1486163 CAGGAACAAGACAGCGTGGGGGG - Exonic
1133069603 16:3236016-3236038 CAGTAAAAAGACTGCGGAGGCGG + Intronic
1133209026 16:4252743-4252765 CAGGGAGAAGTCTGGGTTGGTGG - Intergenic
1133378510 16:5310070-5310092 CAGGAAAGATTCTGGGAAGGAGG - Intergenic
1133494642 16:6305405-6305427 CAGGAAAAAGAAGGAGGAGGAGG - Intronic
1134268442 16:12711922-12711944 CAGGGAAGAGACAGGGGAGGAGG + Intronic
1134884190 16:17775396-17775418 CAGGAAGATGAATGGGGAGGAGG - Intergenic
1136174746 16:28508855-28508877 AAAGAAAAAGAAAGGGTAGGGGG + Intronic
1138505634 16:57476952-57476974 CAGAAAAAAGTCTAGGCAGGAGG - Intronic
1138750724 16:59416997-59417019 CAGGGAAAAGACAAGTTAGGGGG - Intergenic
1139215845 16:65123358-65123380 CGCGAAAAAGACGGGGAAGGAGG + Intronic
1139435200 16:66932860-66932882 CAGGGAAAAGTGTGGGTCGGTGG - Intronic
1139601062 16:67987515-67987537 CAGAATAAGGACTGGGAAGGTGG + Exonic
1141829297 16:86500709-86500731 CAGGAAAAGCACGGGGTTGGCGG - Intergenic
1203013542 16_KI270728v1_random:325919-325941 CAGAAAAAAAACTGGATAGAAGG + Intergenic
1203031877 16_KI270728v1_random:599078-599100 CAGAAAAAAAACTGGATAGAAGG + Intergenic
1203039844 16_KI270728v1_random:735353-735375 CAGAAAAAAAACTGGATAGAAGG - Intergenic
1142565593 17:838044-838066 AAATAAAAAGACTGGGTAGAAGG + Intronic
1143045908 17:4079312-4079334 CAGAAGAAAGACTGGTGAGGGGG + Intronic
1143282742 17:5766931-5766953 CAGGAAAAAGGATAGGGAGGTGG - Intergenic
1144181431 17:12756056-12756078 CAGGAAAGGGACAAGGTAGGGGG + Intronic
1144213040 17:13031375-13031397 CAGTAAAAAAACTGGGCACGTGG + Intergenic
1144495742 17:15743595-15743617 CAGGAGGAAGACCAGGTAGGAGG - Intronic
1145872668 17:28288287-28288309 CTGAAACAAGACTGGGAAGGAGG + Intergenic
1146179307 17:30687106-30687128 AAGGAAAAAGACTGTGAAGGAGG - Intergenic
1146667512 17:34714970-34714992 GAGAAAGAAGAATGGGTAGGGGG + Intergenic
1146744622 17:35316536-35316558 CAGGAATAAGAATGGTAAGGTGG + Intergenic
1146744671 17:35317160-35317182 CAGGAATAAGAATGGTAAGGTGG + Intergenic
1146795202 17:35775461-35775483 AAGGAAAAAGTATGGGAAGGGGG + Intronic
1146938263 17:36825969-36825991 CAGGAAATTGACTGGGAATGTGG - Intergenic
1147816707 17:43215832-43215854 CAGGAAAAAGACGATGAAGGAGG - Exonic
1148008709 17:44456731-44456753 CTGAAACAAGACTGGGAAGGAGG + Intronic
1148235817 17:45968332-45968354 CAGGAAAATGTCTGGATGGGAGG - Intronic
1148681024 17:49473537-49473559 GAGAAAAAAAACTGGGGAGGGGG + Intronic
1148938448 17:51184979-51185001 AGAGAAAAAGACTGGGAAGGGGG + Intronic
1150135888 17:62694937-62694959 CAGGAAACTGACAGGGCAGGAGG - Intergenic
1150357899 17:64504157-64504179 CAAGAAAAAGAGGGGGTAGGTGG + Intronic
1151577959 17:74962353-74962375 CAGGAAGAAGCCGGGTTAGGGGG + Intronic
1151827091 17:76529675-76529697 CAGGGAAAAGACAGGGGAAGAGG - Intronic
1152541608 17:80979568-80979590 CAGGAAGAAGCCCGGGGAGGTGG - Intergenic
1152552398 17:81036105-81036127 CACAAAAACGACTGGGGAGGGGG - Intronic
1152597752 17:81246221-81246243 CAGGAAAAAACCTGGGAAGGAGG - Exonic
1153078428 18:1192628-1192650 CAGGAAAAATAATGGGTACTAGG + Intergenic
1153691892 18:7602291-7602313 CAGTAAAAGGACTGTGAAGGAGG + Intronic
1153844644 18:9038123-9038145 CAGAAAGAAGACTGGGCAGAAGG + Intergenic
1156115393 18:33781114-33781136 CAGAAAACAGATGGGGTAGGAGG + Intergenic
1156140924 18:34110155-34110177 AAAAAAAAATACTGGGTAGGAGG + Intronic
1156252650 18:35365792-35365814 CTGGAAAAATATAGGGTAGGAGG + Intergenic
1156362697 18:36398611-36398633 CAGGAACAAGCCAGGGCAGGTGG + Intronic
1156696837 18:39777999-39778021 AAGAAAAAAGACGAGGTAGGAGG - Intergenic
1156961187 18:43033252-43033274 CAGAAAGAAAACTGGGTAGGAGG + Intronic
1157842141 18:50968296-50968318 CTCGAAAAAGGCTGGGTGGGCGG - Intronic
1158158925 18:54457753-54457775 CAGGGCAATGACTGGGGAGGTGG + Intergenic
1158340456 18:56460396-56460418 CAGAAACTAGAATGGGTAGGAGG + Intergenic
1158668864 18:59456754-59456776 CAGGAAGAGGACTGGGCAGTCGG - Intronic
1161927627 19:7312986-7313008 CCGGGTAAAGACTGGGAAGGCGG - Intergenic
1162768861 19:12937370-12937392 CAGGAAAGAGGGTGGGGAGGGGG - Intergenic
1162979318 19:14228463-14228485 AAGGAAAAAGACTGTGAAGGAGG + Intergenic
1163367731 19:16885289-16885311 CAGGAAGTAGAATGGGTTGGGGG - Intergenic
1164854141 19:31507464-31507486 CAGGGAGAAGACTGTGTAGATGG - Intergenic
1166644892 19:44524572-44524594 AAAGAAAAAGAGTGGGTAGGGGG - Intronic
1168287956 19:55343677-55343699 CAGGAAAAAGAATGAGAAGCTGG + Exonic
1168541840 19:57219266-57219288 CCTAAAAAAGACTGGGCAGGAGG - Exonic
925708421 2:6713414-6713436 CAGGAAAAGGCCTTGGAAGGTGG + Intergenic
926425623 2:12736304-12736326 CAGCAAACAGGCTGGGAAGGAGG + Intronic
927142102 2:20137496-20137518 CAGGAAGAAGGCGGGGTAGTGGG + Intergenic
927324009 2:21782030-21782052 CATGGAAAAGACTGGGATGGAGG + Intergenic
927842244 2:26453158-26453180 CAGGAGAAAGAGTGGGAAGAAGG - Intronic
928224396 2:29435544-29435566 CAGGAAAAAGATTGGGAGAGGGG - Intronic
928534151 2:32223357-32223379 TAGGAAAAACACTGCCTAGGAGG + Intronic
929532011 2:42758694-42758716 AAAGAAAAATACTGGGGAGGAGG - Intergenic
930048608 2:47195368-47195390 CAGGAAACAGACTGGGAAGCAGG - Intergenic
930232203 2:48854747-48854769 CAGAAAAAGGAATGGGAAGGGGG - Intergenic
931639606 2:64370185-64370207 CAGAAAGAAGGCTTGGTAGGTGG - Intergenic
931967643 2:67551022-67551044 CAAGGAAAAGACCGGGGAGGTGG + Intergenic
934712275 2:96523829-96523851 CAGGAAAAAGACAGGGAAAGGGG - Intergenic
935570521 2:104655360-104655382 CATGAAAGAGCCTGGGTAGGAGG + Intergenic
938593117 2:132758722-132758744 CAGGAAGAGGACTGGGATGGGGG + Intronic
940761482 2:157743320-157743342 CAGGAAAGTGACTGAGTATGGGG - Intronic
941515240 2:166465454-166465476 CAGGACAGATGCTGGGTAGGTGG - Exonic
941658451 2:168169839-168169861 CAGGTAAAAGAAGGGGCAGGGGG + Intronic
943160817 2:184247615-184247637 GAGGTAAAAGAATGGGTGGGAGG + Intergenic
943477681 2:188378888-188378910 TTAGAAAAAGACTGGGTAGAAGG + Intronic
943819978 2:192308880-192308902 AATGAAAAAGACTCGGTAAGAGG + Intergenic
946121387 2:217518164-217518186 CAGGAAACAGGCTGGAAAGGAGG + Intronic
946709320 2:222490255-222490277 CAGGAAATATACTTGGTAAGTGG + Intronic
947918166 2:233848156-233848178 CAGGAAAGGGACTGGGCAGAGGG + Intronic
948422761 2:237870701-237870723 CAGGACCAAGGCTGGGGAGGAGG + Intronic
948752323 2:240139814-240139836 CAGGGAACACACTGGGCAGGGGG - Intronic
948765630 2:240217305-240217327 CAGGAAAGAAAATGGGTGGGAGG + Intergenic
1169302626 20:4457419-4457441 CAGGAAAAATAATGGGTACTAGG + Intergenic
1169392115 20:5198744-5198766 AAGGAAAAAAACTGGGCAGAGGG - Intergenic
1169636442 20:7697179-7697201 CAGGAAACAGAGTGTGAAGGGGG + Intergenic
1171322939 20:24262357-24262379 CAGGAAAAAGGCAGTGGAGGAGG - Intergenic
1174773786 20:53325024-53325046 CAGGGAAAAGACTTGGCAAGTGG + Intronic
1174793073 20:53498193-53498215 TAGGAAGAAGCCTGGCTAGGTGG - Intergenic
1177202691 21:17975591-17975613 CAAGAAAAAGAGTGGGTTTGAGG - Intronic
1177957486 21:27617264-27617286 CAGGAAGAAGTGTGGGTGGGGGG + Intergenic
1178625774 21:34217331-34217353 CTGGAGAGAGACTGGGTAGCTGG - Intergenic
1180002011 21:44999387-44999409 AAGGAAAAGGACTGGGCTGGAGG + Intergenic
1181099779 22:20531499-20531521 CAGGAAGCAGACAGGGGAGGAGG - Intronic
1182318468 22:29463360-29463382 AAGGCAAAAGACTTGGGAGGCGG + Intergenic
1182371526 22:29814624-29814646 CAGGAAAGAGACTGGGCCGAAGG + Intronic
1182777742 22:32843436-32843458 CAGGAAAAAGGCTTGCTTGGCGG + Intronic
1182855286 22:33511622-33511644 CTGGAAAAGGACTTGGTAGAAGG + Intronic
1184965554 22:47969537-47969559 CAGAAGGAAGAATGGGTAGGTGG - Intergenic
949147084 3:714762-714784 CAGGGAATATACTGGGTGGGTGG - Intergenic
949795084 3:7841050-7841072 CCTGAAAAAGATTGGCTAGGAGG + Intergenic
950037190 3:9895080-9895102 CAGGAAGAGGAATGGGTATGAGG - Intergenic
950144868 3:10641854-10641876 TAGGTAAATGAGTGGGTAGGTGG - Intronic
952022149 3:29036038-29036060 CAGGAAAAAACCGGGGTCGGGGG - Intergenic
952204810 3:31170635-31170657 CCGCAAAAAGACTGGATAGGAGG + Intergenic
952716108 3:36482555-36482577 CAGGAAAATGACTGATTAAGGGG - Intronic
953441838 3:42924961-42924983 CATAGAAAAGACTGGGTTGGAGG + Intronic
955277578 3:57561317-57561339 CAGGAAAAAGGTTGAGTAGTGGG + Exonic
955796755 3:62645194-62645216 CAGGGGAAAGAGTGGGAAGGGGG + Intronic
955984683 3:64560336-64560358 CAGGAAAAAGACTGAGTAGATGG + Intronic
956603606 3:71049629-71049651 CAGGAAAAAAAGGGGGTGGGGGG + Intronic
956751248 3:72345706-72345728 AAGGAAATAGACTGGGTGTGGGG - Intergenic
957221156 3:77384611-77384633 CAGGCAAAGTACTGGGTAGAGGG - Intronic
959260749 3:104076876-104076898 CAGGAAACACACTGTGTATGCGG + Intergenic
959580403 3:107977347-107977369 CTGGAAAACTACTGGGAAGGGGG + Intergenic
959597275 3:108142253-108142275 GAGGAACAAGGCTGTGTAGGAGG - Intergenic
961508969 3:127389815-127389837 CTGGACAAAGACTTGGTAGTGGG + Intergenic
961576654 3:127842343-127842365 CAGGAAAATGTCAGGGAAGGGGG - Intergenic
961765008 3:129203221-129203243 CAGGAGCAAGACAGTGTAGGGGG - Intergenic
965721689 3:171668947-171668969 CAGGAAAAGGCATGGGTAGCAGG - Intronic
965796970 3:172449395-172449417 AAGGAAAAAGGCAGGGTTGGAGG + Intergenic
965912323 3:173794103-173794125 CAGGCAAAGGGCTGGGTATGAGG - Intronic
966796385 3:183718602-183718624 CTGGAAAATGACTGGGTATGAGG - Intronic
967314099 3:188134497-188134519 CAGGAAAAATAATGGGTACTAGG + Intergenic
967979199 3:195055377-195055399 CAGGAGAAAGCCCAGGTAGGGGG - Intergenic
969987601 4:11227572-11227594 CAGGAAGAAGACTGCATAAGAGG + Intergenic
970127431 4:12830795-12830817 AAGGAAAAAGACTGGGTAAACGG - Intergenic
970224822 4:13846720-13846742 CAGGAAAAAGACTAGAAATGGGG - Intergenic
971369859 4:26009690-26009712 CAGGGAAGGAACTGGGTAGGTGG - Intergenic
974013644 4:56629608-56629630 CAGGGGAATGACTGGGTAGGAGG - Intergenic
974876722 4:67711697-67711719 GAGGGAAACGACTGTGTAGGAGG + Intergenic
975693063 4:76984698-76984720 TAGGATAAAGACAGGGCAGGAGG + Intronic
976200133 4:82569877-82569899 CAGGGTAAAGACTGGGCAGTTGG - Intergenic
976695659 4:87917462-87917484 TAGGAAAAAGAAGGGGTTGGGGG + Intergenic
977393028 4:96437433-96437455 CAGGAGAGAAACAGGGTAGGGGG + Intergenic
977830908 4:101591462-101591484 CAGGAAAAATAATGGGTACTAGG + Intronic
978384990 4:108169319-108169341 GAGGAAAAGGAGTGGGTGGGTGG - Intergenic
978420134 4:108523454-108523476 CAGGAAAGAGACTCGGAAGCAGG + Intergenic
979271857 4:118771912-118771934 CATGAAAAAAACAGGGTATGAGG + Intronic
979909542 4:126344542-126344564 AAGGAAAAAGAGAGGGAAGGAGG + Intergenic
980065580 4:128184740-128184762 CAGGGACTAGAATGGGTAGGGGG - Intronic
981339163 4:143600319-143600341 CAGGAAAAAGGCTGGGAGGTAGG + Intronic
981992438 4:150938781-150938803 CAGGTGAAAGTCTGGGTAGCGGG - Intronic
983525001 4:168751826-168751848 CTAGAAAAAGAGTGGGTAGAGGG + Intronic
985108529 4:186522916-186522938 CAGGAAAAAGACTGGGTAGGTGG + Intronic
985503828 5:266455-266477 CAGGAAAACCACTGGGCAGTGGG + Intergenic
985622093 5:961100-961122 CAGGAAAGAGACGGAGAAGGGGG - Intergenic
985622362 5:962364-962386 GAGGAAACAGACAGGGCAGGTGG + Intergenic
985708343 5:1414382-1414404 CAGGAAAGGCACTGGGTGGGGGG + Intronic
985920616 5:2969561-2969583 CTGTAAAAAGCCTGGGTAGGAGG + Intergenic
986550378 5:8947285-8947307 AAGGAAAAAGACTGGCTAAAAGG + Intergenic
986593067 5:9391501-9391523 CAGGAAGTAGACTGGGGAAGGGG - Intronic
988355320 5:30166400-30166422 CAGGAGAAAGGGTGGGTAGAGGG - Intergenic
989245857 5:39253799-39253821 CAGGAAAAATATTGGGTACTAGG - Intronic
990422218 5:55647097-55647119 AAGAAAAAAGACTGGTGAGGGGG + Intronic
990726868 5:58765940-58765962 GAGGAAGAAGAGTGGGCAGGGGG - Intronic
991042676 5:62192213-62192235 CAAGAAAGAGAATGGGTTGGGGG - Intergenic
993275505 5:85851418-85851440 CAGGAAAAAGAGAGAGAAGGAGG + Intergenic
993948087 5:94138680-94138702 CAGGGAAAAGAGTGGGCAGGGGG - Intergenic
994300590 5:98142501-98142523 AAGGCAGAAGACTGGTTAGGAGG - Intergenic
994586755 5:101718554-101718576 TAGGAAGAAGACTTGGTAGTAGG - Intergenic
994956100 5:106535139-106535161 CAGGAAAAATAATGGGTACTAGG - Intergenic
995240087 5:109875776-109875798 CAGGAAAAAGAGTTCTTAGGAGG - Intergenic
996019278 5:118573974-118573996 CAGGAAAAATAATGGGTACTAGG - Intergenic
996330296 5:122321020-122321042 CAGGAGAAAATCTGGGGAGGCGG - Intronic
996632283 5:125648199-125648221 TGGGAAAAAGACTGGGAAGGGGG + Intergenic
997446139 5:133941799-133941821 AAGGGAAGAGACAGGGTAGGGGG - Intergenic
997990543 5:138542114-138542136 CAGGAGAAATACGGGTTAGGGGG - Intronic
998513908 5:142735955-142735977 CAGGAATAACCCTGGGTAGGAGG + Intergenic
999698595 5:154207669-154207691 CAGGGAAATGGCTGGGCAGGGGG + Intronic
1000391084 5:160724154-160724176 CAGGAAAAATAATGGGTATTAGG + Intronic
1001672452 5:173485384-173485406 CAAGAAAACTACTGGCTAGGAGG + Intergenic
1001910756 5:175515552-175515574 CATGTAAAACACTGGGTATGCGG - Intronic
1002024509 5:176388003-176388025 GAGAAAAAAGACTGAGTAGAGGG + Intronic
1002770504 6:286801-286823 CTGAAAAATGTCTGGGTAGGGGG - Intergenic
1002904730 6:1438987-1439009 CAGGGTAAAGGCTGGGTGGGGGG - Intergenic
1003501951 6:6710368-6710390 AAGGAGGAATACTGGGTAGGGGG + Intergenic
1004168525 6:13277446-13277468 CAGGAACAAGACAAGGCAGGAGG - Intronic
1005255442 6:23997753-23997775 CAGGGAATAACCTGGGTAGGGGG + Intergenic
1005334647 6:24782087-24782109 AAGGAAAAAAAAAGGGTAGGGGG + Intronic
1005876042 6:30010231-30010253 CAGGAAAGAGACCTGGAAGGAGG - Intergenic
1006742606 6:36320268-36320290 CTGGAACAAGAATGGGAAGGCGG + Intronic
1006941176 6:37753350-37753372 CAGGCAATTGACTGGGGAGGGGG - Intergenic
1009292919 6:61906543-61906565 CAGGAAGAATAGTGGGAAGGAGG - Intronic
1011074429 6:83423162-83423184 CAGGAAAAAGAAAGGGCGGGAGG + Intronic
1011881674 6:92035342-92035364 TAGGAAAATGGCTGGGTAGTGGG + Intergenic
1012712190 6:102621063-102621085 CAGGGCAAAGGGTGGGTAGGGGG - Intergenic
1013016503 6:106164761-106164783 GACGAATCAGACTGGGTAGGAGG + Intergenic
1014892403 6:126858818-126858840 CAGGTAAAAGACTAGATAGAAGG - Intergenic
1014925516 6:127266431-127266453 CAAGAAAAAAAATGGGGAGGGGG - Intergenic
1015386715 6:132633049-132633071 CAAGGGAAAGAATGGGTAGGAGG + Intergenic
1016139305 6:140587937-140587959 CAGGAAAAAGAGTGTGAAGGAGG + Intergenic
1016498207 6:144689033-144689055 CAGGAGAGTGACTGGGTAGTGGG - Intronic
1016824320 6:148374281-148374303 CAGGAATATGAATGGGAAGGAGG + Intronic
1016969048 6:149745757-149745779 CAGAAAAAGGACTGGGAAAGGGG - Intronic
1017150339 6:151273694-151273716 ATGGAAAAAGAATGGCTAGGTGG + Intronic
1017247692 6:152244885-152244907 CAGGAGAAAGTCAGGGTAGAGGG + Intronic
1018276096 6:162133183-162133205 TAGGAATAGGACTGGGCAGGAGG + Intronic
1018896580 6:168023211-168023233 GTGGAAAAAGGCTGGGTAGAAGG - Intronic
1019534938 7:1523904-1523926 CAGGAAGAAGCGAGGGTAGGAGG + Intergenic
1020222414 7:6250017-6250039 CAGGGAAGAGACTGGGATGGGGG - Intronic
1020770986 7:12394368-12394390 CAGGAAAACGAATGGGATGGAGG + Intronic
1021675936 7:23080959-23080981 CAGGAAAAAGGCAGGCTAGGAGG + Intergenic
1021700602 7:23315769-23315791 AAGGAAAAATACGGGGTAGGTGG + Intronic
1023422312 7:39994328-39994350 CAGTAACAACACTGGGTTGGGGG - Intronic
1023422512 7:39997159-39997181 CAGTAAAGAAACTGGGTACGGGG - Intronic
1023732070 7:43201630-43201652 CAGGAAAAAGACTTGGAAAGTGG - Intronic
1025945392 7:66100443-66100465 GAGGAAAAAGAATGAGGAGGAGG + Intronic
1026502638 7:70956176-70956198 AAGGGAAAAGAGTGGGCAGGAGG - Intergenic
1026919392 7:74144194-74144216 AAGGAGAAAGAGTGGGCAGGAGG - Intergenic
1028385737 7:90251033-90251055 CTGGGAGAAGACTGGGTTGGAGG - Intronic
1029535515 7:101155106-101155128 CCGGAAAGAGAATGGGAAGGGGG - Intronic
1029955208 7:104631510-104631532 TGTGAAAAAGACTGGGTTGGAGG + Intronic
1032017157 7:128387658-128387680 AAGGAAAGAGGCTGGCTAGGTGG - Intergenic
1032378508 7:131449696-131449718 TGGGAAAAAGAATGGGAAGGAGG - Intronic
1032562451 7:132906612-132906634 AAGGAAAAAGATTGGGGCGGGGG - Intronic
1033509314 7:142039068-142039090 CAGGAACAAGACGGGGTGGGGGG + Intronic
1033899570 7:146118571-146118593 CAGGAAAAACCCTGGATATGAGG - Intronic
1033922752 7:146414651-146414673 TTGGAAAAAGACTAGGTTGGGGG + Intronic
1035120613 7:156563772-156563794 CAGGAGAGGGACCGGGTAGGAGG - Intergenic
1035958329 8:4108096-4108118 CAAGAAAAAGACGGAGGAGGAGG + Intronic
1035972798 8:4270288-4270310 CAGTATAAAGACTGGGAAGAAGG - Intronic
1037711891 8:21361432-21361454 CAGGATAAGAACTGGGTAGAAGG - Intergenic
1038740854 8:30215445-30215467 CATGAAAATGACTGGGCAGATGG - Intergenic
1039071547 8:33653286-33653308 CAGGAAGAAGGCTGGGTGGTGGG + Intergenic
1039803244 8:40977848-40977870 CTGGAAAAAGGCAGGGCAGGAGG - Intergenic
1041692078 8:60698330-60698352 CAGGAAGAATATAGGGTAGGTGG + Intronic
1042430936 8:68705804-68705826 CAGAAAAAATACTGGTTGGGGGG + Intronic
1044078480 8:87854697-87854719 CAAGAAGAAGGCTGGGTGGGAGG + Intergenic
1044632157 8:94290483-94290505 AAGGAAAGAGACTGGGTGAGGGG - Intergenic
1045905436 8:107339372-107339394 CAGAAAGAAGACTGTGTAGTTGG - Intronic
1046041101 8:108906059-108906081 AAGCAGAAAGACTGGTTAGGAGG - Intergenic
1046069930 8:109238488-109238510 TAGGTAAAAGAATGGGTAAGTGG + Intergenic
1046092877 8:109524249-109524271 CAGGGAAAAAACTGGGGAGAGGG - Intronic
1046342956 8:112882532-112882554 AAGGGAAAAGAGTGGGAAGGAGG - Intronic
1046852329 8:118988500-118988522 AAGGAAATAGACTGGGAATGAGG + Intergenic
1048229794 8:132627619-132627641 CAGGAGAGAGAATGGGTTGGAGG - Intronic
1048269860 8:133019934-133019956 CAGGAAGAAGACTGTGGACGTGG + Intronic
1049181963 8:141227584-141227606 CAGGAAAGACACTGGGCCGGGGG + Intronic
1049216001 8:141408696-141408718 CAGGACAGAGTCTGTGTAGGCGG - Intronic
1049402890 8:142438266-142438288 CAAGAGAGAGACTGGGTAGGGGG + Intergenic
1049606231 8:143530415-143530437 CAGGGAAAAGTCATGGTAGGTGG - Intronic
1049748903 8:144274406-144274428 CAGGAAAGAGGCTTGGGAGGTGG - Intronic
1049824381 8:144658762-144658784 CAGGAAAAAGAAAAGGTAGAAGG + Intergenic
1050375819 9:4971730-4971752 GAGGAGGAAGATTGGGTAGGAGG - Intergenic
1050546897 9:6716801-6716823 CAAGAAAAAGTCTTGGCAGGAGG - Intergenic
1052069131 9:24059713-24059735 CAGGAAAATGACTGTCTAAGCGG - Intergenic
1052393547 9:27909813-27909835 CAGGAAAAATAATGGGTACTGGG + Intergenic
1055724274 9:79210854-79210876 CAGCAACAAGCCTGGGAAGGAGG + Intergenic
1058705747 9:107636948-107636970 GAGGAAGAAGAGAGGGTAGGGGG + Intergenic
1059344688 9:113620223-113620245 CAAGAAAGAAACTGGGTCGGTGG + Intergenic
1059651889 9:116322869-116322891 TAGGAAAAGGAATGGGGAGGAGG - Intronic
1060455744 9:123794174-123794196 CAGGAAAAGGACTAGGCTGGCGG + Intronic
1061307363 9:129739815-129739837 CAGGAAAAGGAAGGGGTAGATGG + Exonic
1185688208 X:1948057-1948079 AAGGAATAAGACAGGGGAGGAGG + Intergenic
1185688497 X:2133596-2133618 AAGGAATAAGACAGGGGAGGAGG + Intergenic
1186977196 X:14920551-14920573 CATAAAAATGACTGGATAGGGGG - Exonic
1187250048 X:17589307-17589329 GAGTAAAAAGAGTGGGAAGGTGG - Intronic
1187656131 X:21476092-21476114 AAAGAAAAAGAATGGGTAAGAGG + Intronic
1188981789 X:36733466-36733488 CAGGGGGAGGACTGGGTAGGGGG - Intergenic
1189497944 X:41526441-41526463 CATGATAAGGACTGGGTAGCTGG - Intronic
1189782747 X:44531696-44531718 CAGGAAAAAGGTTGGGGAGGGGG + Intronic
1190757451 X:53413224-53413246 CAGGAGAAAGAAGAGGTAGGTGG - Exonic
1190819789 X:53962778-53962800 GAGGAAATAGACAAGGTAGGTGG - Intronic
1191671874 X:63755418-63755440 GAGGAAAAGGACTGGGAAAGAGG + Intronic
1195392926 X:104381853-104381875 AAAGAGAAAGTCTGGGTAGGTGG - Intergenic
1195845470 X:109223041-109223063 CAGGAAAGAGACAGGCTAGCAGG + Intergenic
1196116532 X:112005337-112005359 CAGGAAAAATAATGGGTACTAGG + Intronic
1196679961 X:118460632-118460654 CAGTACAAAGAATGGGAAGGGGG - Intergenic
1196800368 X:119537856-119537878 CAGGAAAATAACTGGGAAGAAGG + Intergenic
1197162727 X:123342249-123342271 CAGGAAATAGAGTGGGGATGGGG - Intronic
1197820806 X:130538991-130539013 TAGGGGAAAGCCTGGGTAGGGGG + Intergenic
1197902779 X:131392147-131392169 CAGGAAAGAGAGTGGGGAGGGGG - Intronic
1199253555 X:145692900-145692922 CAGCAAAAACGCTGGGGAGGTGG + Intergenic
1199673281 X:150164184-150164206 AAGGAAACAGCCTGGGTTGGCGG - Intergenic
1201567933 Y:15385920-15385942 CAGGAGAAAGAGGGGGAAGGGGG - Intergenic
1202246594 Y:22826559-22826581 TAGGAAAAAAACTTGGCAGGAGG - Intergenic
1202399583 Y:24460307-24460329 TAGGAAAAAAACTTGGCAGGAGG - Intergenic
1202471197 Y:25209779-25209801 TAGGAAAAAAACTTGGCAGGAGG + Intergenic