ID: 985111932

View in Genome Browser
Species Human (GRCh38)
Location 4:186555308-186555330
Sequence CGTCCCCGCGGAGCACGGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 113}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985111926_985111932 -6 Left 985111926 4:186555291-186555313 CCACGAGGGCCGCGCGCCGTCCC 0: 1
1: 0
2: 1
3: 28
4: 304
Right 985111932 4:186555308-186555330 CGTCCCCGCGGAGCACGGGCTGG 0: 1
1: 0
2: 1
3: 13
4: 113
985111922_985111932 10 Left 985111922 4:186555275-186555297 CCAGGGCGGACGCCAGCCACGAG 0: 1
1: 0
2: 0
3: 5
4: 76
Right 985111932 4:186555308-186555330 CGTCCCCGCGGAGCACGGGCTGG 0: 1
1: 0
2: 1
3: 13
4: 113
985111925_985111932 -2 Left 985111925 4:186555287-186555309 CCAGCCACGAGGGCCGCGCGCCG 0: 1
1: 0
2: 2
3: 6
4: 129
Right 985111932 4:186555308-186555330 CGTCCCCGCGGAGCACGGGCTGG 0: 1
1: 0
2: 1
3: 13
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985111932 Original CRISPR CGTCCCCGCGGAGCACGGGC TGG Exonic
900101541 1:964208-964230 GGGCCCCGCGGCGCACGGGAGGG - Intronic
900109617 1:1000009-1000031 CGCCGCCACGGACCACGGGCGGG + Exonic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
902304045 1:15524029-15524051 TGTCCCCGCGCTGCACGGCCGGG - Intronic
906062490 1:42958053-42958075 CGTCACCGCGGGGGACTGGCGGG + Intronic
906481632 1:46203303-46203325 CGCCCCCGCGCCGCGCGGGCGGG + Intronic
913565656 1:120069775-120069797 CCTCCGCGCGGAGCTCGGGCCGG - Intergenic
913632473 1:120723778-120723800 CCTCCGCGCGGAGCTCGGGCCGG + Intergenic
914286252 1:146229149-146229171 CCTCCGCGCGGAGCTCGGGCCGG - Intergenic
914547280 1:148679891-148679913 CCTCCGCGCGGAGCTCGGGCCGG - Intergenic
914619223 1:149390452-149390474 CCTCCGCGCGGAGCTCGGGCCGG + Intergenic
919419724 1:197355428-197355450 CGGCGCCGCGGAGCAGGGGGTGG + Intronic
1069026494 10:63548096-63548118 AGTCCCCGCTGAACACAGGCTGG - Intronic
1070570651 10:77637752-77637774 CGCCGCCGCGGAGCGCGGGAGGG + Intronic
1070835499 10:79444978-79445000 CCTCCCGGCTGAGCCCGGGCTGG - Intronic
1076554134 10:131311293-131311315 CTTCCCCGCGCTCCACGGGCAGG - Exonic
1082810491 11:57476542-57476564 CGGCCTCGCGGAGCGCGCGCAGG - Exonic
1091282906 11:134391968-134391990 GGTCCCCGTGGAGCACCTGCCGG - Exonic
1092430465 12:8404459-8404481 CCTCCCCGCGGGGCACGGCTCGG + Intergenic
1103348268 12:120265466-120265488 CAGCCCCGCGGAGCCCCGGCCGG + Intronic
1103521179 12:121537692-121537714 CGTCCCCGTGGGGAAAGGGCCGG + Intronic
1103844262 12:123890608-123890630 CGTCCCCACGGCGCACTGGAGGG - Intronic
1104940351 12:132392130-132392152 GGTCCCCGGGGAGAACGGGGTGG - Intergenic
1104940404 12:132392244-132392266 GGTCCCCGGGGAGAACGGGGTGG - Intergenic
1104940431 12:132392301-132392323 GGTCCCCGGGGAGAACGGGGTGG - Intergenic
1104940458 12:132392358-132392380 GGTCCCCGGGGAGAACGGGGTGG - Intergenic
1104940485 12:132392415-132392437 GGTCCCCGGGGAGAACGGGGTGG - Intergenic
1104940512 12:132392472-132392494 GGTCCCCGGGGAGAACGGGGTGG - Intergenic
1105539044 13:21298489-21298511 TGGCCGCGCGGAGCAGGGGCCGG - Intergenic
1105593916 13:21818181-21818203 CCTCCCTGCGGGGCAGGGGCTGG + Intergenic
1107851491 13:44576810-44576832 GGTCCTCGCGGAGCACGGCCGGG + Intronic
1113659137 13:112092795-112092817 GGTCCCAGAGGAGCCCGGGCAGG - Intergenic
1115906742 14:38209779-38209801 CGTCCACGCTGAGCACGAGGCGG - Exonic
1119808615 14:77498675-77498697 CGGCTCCGCGGACCACGGCCTGG - Exonic
1120780238 14:88479933-88479955 CGTGCTCGCGGATCTCGGGCTGG + Exonic
1122415677 14:101548510-101548532 AGGCCCTGGGGAGCACGGGCTGG + Intergenic
1124696891 15:31870813-31870835 CGTCCGCGCGGGGCGGGGGCGGG - Intergenic
1125903682 15:43371101-43371123 AGTCTCCGCAGAGCCCGGGCGGG + Exonic
1129450158 15:75647253-75647275 CGTCCCTGCGGAGCAGGAGTGGG + Intronic
1130370931 15:83284738-83284760 CGTCCCCGGGGCGCAGGGGGCGG - Intergenic
1132544666 16:527759-527781 CGTAGCCGCGGGGCCCGGGCCGG + Intronic
1132607693 16:800398-800420 CGTCCACGGGGTGCACGGGGTGG - Intronic
1132611326 16:817700-817722 CGGCCCCACGGGGCCCGGGCAGG + Intergenic
1133090613 16:3401213-3401235 CGACACCGGCGAGCACGGGCTGG - Intronic
1133326369 16:4944730-4944752 TGTCCCCTCGGAGCAGGGACAGG - Intronic
1136536316 16:30902029-30902051 CGGGGCCCCGGAGCACGGGCAGG - Intronic
1137731451 16:50693523-50693545 GGTCCCGGCAGAGCAGGGGCGGG + Intergenic
1138360637 16:56425036-56425058 CGGGCCCGCGGGGCAGGGGCGGG - Intronic
1140946197 16:79770540-79770562 CGGCGTCGCGGAGCTCGGGCCGG - Intergenic
1141901778 16:86995745-86995767 CATCCCCGCGTACCACTGGCCGG + Intergenic
1142347983 16:89566042-89566064 CGCCCCCGGGGAGCACGGGCTGG + Exonic
1143096540 17:4481287-4481309 CCTCCCAGCAGAGCAGGGGCAGG + Intronic
1152639097 17:81442324-81442346 AGGCCCCCCGGAGCCCGGGCCGG + Exonic
1152681364 17:81670051-81670073 CGTCCCCGGGGATGCCGGGCCGG + Intronic
1153688389 18:7567912-7567934 CGCCCCCGAGGCGCGCGGGCCGG + Intronic
1154231107 18:12557179-12557201 GGTCGCCGCGGAGCAGGGGGTGG + Intronic
1156449648 18:37259648-37259670 GGTCCCCCCAGAGCAGGGGCAGG - Intronic
1161072826 19:2270957-2270979 TGTCCCCGCGAAGACCGGGCGGG - Intronic
1161400803 19:4065712-4065734 CCTCCCCGGGGAGCGCGGGGAGG + Intronic
1161407617 19:4099258-4099280 CTTCCCCGTCGACCACGGGCCGG + Exonic
1161467128 19:4437227-4437249 CGTCCCTGGGGAGCAGGGTCTGG + Intronic
1161682683 19:5687795-5687817 CGCCGCCGCGGATCACGGCCAGG - Intronic
1162572416 19:11480881-11480903 CGGCCCCGCGGGGCCCGGGGAGG + Exonic
1162784403 19:13025242-13025264 AGTCCTCGCGGAACTCGGGCCGG - Exonic
1162987146 19:14277934-14277956 CGGCGCCGCGGAGCAGGGGGCGG - Intergenic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
1166113894 19:40640906-40640928 CTTCCCAGCGGAGCCCGGGCAGG + Intergenic
1166759913 19:45218003-45218025 CCTCCCCGCAGACCCCGGGCAGG + Intronic
1167045190 19:47045510-47045532 CGGCCCCGCGGAGCTGGGCCTGG + Exonic
931428915 2:62195051-62195073 CCTCCCCGCGGAGCGCACGCGGG + Intergenic
934521986 2:95025577-95025599 GGTGCCCGCGGCGCTCGGGCCGG + Intergenic
937369013 2:121285010-121285032 GGTCCCCGCGGGTCTCGGGCCGG - Intronic
939629424 2:144515992-144516014 GGTCCCCGCGAGGCGCGGGCTGG + Intronic
940265000 2:151827812-151827834 CGTCCCTGAGTAGCACGGCCTGG - Intronic
942965972 2:181892287-181892309 CCTCCCCCCGGAGCCCGGCCGGG - Intronic
946313993 2:218897642-218897664 CGGCCTGGCGGAGGACGGGCGGG - Intronic
949026263 2:241767816-241767838 CGTCAGCGCGGAGCACGGAGTGG + Exonic
1169143443 20:3238508-3238530 CGTCCCGGCGGCCCACGTGCAGG + Intronic
1173663589 20:44750627-44750649 CGCCCCCGGGGGGCGCGGGCTGG - Exonic
1175873758 20:62220103-62220125 CGGCCCCGCGGACCATGCGCTGG - Exonic
1180004607 21:45014565-45014587 CGCCCCCGCCGAGCAGGGCCTGG + Intergenic
1180137731 21:45871951-45871973 CGTCCCCCCAGGGGACGGGCTGG + Intronic
1180967484 22:19798154-19798176 CGGCCCCGCGCAGCAGGTGCTGG - Intronic
1184153029 22:42649384-42649406 CGTCACTCCGGAGCAGGGGCGGG + Intronic
952241328 3:31533335-31533357 GTTCCCCGCGGGCCACGGGCGGG - Intronic
955927619 3:64023317-64023339 CGTCTCCGCGGTGCTCGGGCAGG + Exonic
966108162 3:176362257-176362279 CGGCGCCGCGGAGCAGGGGGCGG + Intergenic
966787842 3:183636456-183636478 CGTCCCCGGGGAGCCGGGGCGGG + Intronic
967915935 3:194578207-194578229 TGTCCCAGCCGAGCAGGGGCTGG - Intergenic
968759514 4:2434832-2434854 CGTCCCTGCAGTGCAGGGGCTGG - Intronic
976629324 4:87220552-87220574 CGGCCCCGCGGAGCCCCGGCGGG + Exonic
985111932 4:186555308-186555330 CGTCCCCGCGGAGCACGGGCTGG + Exonic
985832183 5:2242022-2242044 GGTCCCCGGGGAGCCAGGGCAGG - Intergenic
993904129 5:93604343-93604365 CATCCCGGCGGAGCGCGGCCCGG - Intergenic
995529154 5:113075265-113075287 CCTCCCCGCGGAGCAGGGCTTGG + Intronic
1001261597 5:170233724-170233746 CCTCCCCGGGGAGCTCGGCCAGG - Exonic
1001902632 5:175444379-175444401 GATCCCCGCGCAGCACGCGCAGG + Intergenic
1002139924 5:177132557-177132579 CGTCCCGGCTGGGCCCGGGCTGG + Intergenic
1002421165 5:179149812-179149834 GGTTCCCGAGGAGCACAGGCTGG - Intronic
1002524142 5:179806353-179806375 CGTCCTCGCGCCGCCCGGGCGGG + Intronic
1003078096 6:2999921-2999943 CGCCCCCGGGGACCACGGACCGG - Intronic
1003873640 6:10419475-10419497 GGTCCCCGCCGGGCATGGGCTGG + Intronic
1004200291 6:13541771-13541793 CCTCCCCGCGGGGCAGGGCCCGG + Intergenic
1004280460 6:14275735-14275757 CGTCCCTGCGCATCAGGGGCAGG - Intergenic
1007330149 6:41100824-41100846 CTTCCCCGGGGAGAAGGGGCTGG - Intergenic
1017695976 6:157016682-157016704 CATCCCTGCAGAGCACAGGCGGG - Intronic
1019271125 7:149837-149859 CGTCCCCGCCGAGGCCAGGCAGG - Intergenic
1019421978 7:954791-954813 GGTCCCCGGGGCGCGCGGGCTGG - Intronic
1019472725 7:1229902-1229924 CGTCCCCCTGGACCGCGGGCTGG + Intergenic
1020133005 7:5570079-5570101 CGTCCCGGGGGAGCAAGGCCTGG - Intergenic
1021573954 7:22090755-22090777 GGGCACCGCGGAGCACGGGGTGG - Intergenic
1022045150 7:26616894-26616916 CGTCACCGCTGTGCACGGGGAGG + Intergenic
1024579896 7:50793154-50793176 CGTCCCCGCGGGGCCCGGGACGG - Intronic
1026806685 7:73433651-73433673 CGGCCACGCGGAGCACGGGGTGG - Intergenic
1034578841 7:152025612-152025634 CGTCACCGCGGCGCGGGGGCGGG + Intergenic
1035022678 7:155808592-155808614 AGGCCGCGCGGAGCCCGGGCCGG - Intronic
1037803977 8:22049304-22049326 GGTCCCCGCGGGGCCGGGGCGGG + Intronic
1038575850 8:28702317-28702339 CGGCCTCGCGCTGCACGGGCTGG + Intronic
1049642359 8:143721431-143721453 CGCCCACGCGGAGCACGGCCCGG + Intronic
1056080911 9:83093329-83093351 GGGCCCCGCGGAGCAGGGGGTGG + Intergenic
1056968118 9:91180800-91180822 GGTCCCTGCTGAGCCCGGGCTGG - Intergenic
1057545877 9:96020479-96020501 CGGCCCCGCGGAGCCCAGGTAGG + Intergenic
1061786401 9:133031050-133031072 CGTCCCCGTGGAGCTGAGGCGGG + Exonic
1062121617 9:134836805-134836827 GGCCCCCGCTGAGCACGGCCTGG - Intronic
1186426211 X:9465601-9465623 TGTCCCCGCGGCGCTCGGACTGG + Intronic
1187826092 X:23334502-23334524 CGTCCCCTCTCAGCGCGGGCGGG - Exonic
1198005588 X:132489701-132489723 CGGGCCAGCGGAGCGCGGGCGGG + Intronic
1200051622 X:153435000-153435022 GGTCCACTGGGAGCACGGGCTGG - Intergenic