ID: 985114589

View in Genome Browser
Species Human (GRCh38)
Location 4:186578242-186578264
Sequence TAGCTTTCTGAAGGTCAACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985114589_985114599 28 Left 985114589 4:186578242-186578264 CCGCGTTGACCTTCAGAAAGCTA No data
Right 985114599 4:186578293-186578315 AGTGGGGATTGCGGCGACAGGGG No data
985114589_985114596 19 Left 985114589 4:186578242-186578264 CCGCGTTGACCTTCAGAAAGCTA No data
Right 985114596 4:186578284-186578306 TTGAGTCAAAGTGGGGATTGCGG No data
985114589_985114595 12 Left 985114589 4:186578242-186578264 CCGCGTTGACCTTCAGAAAGCTA No data
Right 985114595 4:186578277-186578299 AGTAGACTTGAGTCAAAGTGGGG No data
985114589_985114593 10 Left 985114589 4:186578242-186578264 CCGCGTTGACCTTCAGAAAGCTA No data
Right 985114593 4:186578275-186578297 GCAGTAGACTTGAGTCAAAGTGG No data
985114589_985114598 27 Left 985114589 4:186578242-186578264 CCGCGTTGACCTTCAGAAAGCTA No data
Right 985114598 4:186578292-186578314 AAGTGGGGATTGCGGCGACAGGG No data
985114589_985114594 11 Left 985114589 4:186578242-186578264 CCGCGTTGACCTTCAGAAAGCTA No data
Right 985114594 4:186578276-186578298 CAGTAGACTTGAGTCAAAGTGGG No data
985114589_985114597 26 Left 985114589 4:186578242-186578264 CCGCGTTGACCTTCAGAAAGCTA No data
Right 985114597 4:186578291-186578313 AAAGTGGGGATTGCGGCGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985114589 Original CRISPR TAGCTTTCTGAAGGTCAACG CGG (reversed) Intergenic
No off target data available for this crispr