ID: 985114591

View in Genome Browser
Species Human (GRCh38)
Location 4:186578269-186578291
Sequence TGACTCAAGTCTACTGCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985114591_985114603 26 Left 985114591 4:186578269-186578291 CCCAATGCAGTAGACTTGAGTCA No data
Right 985114603 4:186578318-186578340 CCCATCAACCAGAAGAGGACGGG No data
985114591_985114600 21 Left 985114591 4:186578269-186578291 CCCAATGCAGTAGACTTGAGTCA No data
Right 985114600 4:186578313-186578335 GGGAGCCCATCAACCAGAAGAGG No data
985114591_985114599 1 Left 985114591 4:186578269-186578291 CCCAATGCAGTAGACTTGAGTCA No data
Right 985114599 4:186578293-186578315 AGTGGGGATTGCGGCGACAGGGG No data
985114591_985114596 -8 Left 985114591 4:186578269-186578291 CCCAATGCAGTAGACTTGAGTCA No data
Right 985114596 4:186578284-186578306 TTGAGTCAAAGTGGGGATTGCGG No data
985114591_985114598 0 Left 985114591 4:186578269-186578291 CCCAATGCAGTAGACTTGAGTCA No data
Right 985114598 4:186578292-186578314 AAGTGGGGATTGCGGCGACAGGG No data
985114591_985114601 25 Left 985114591 4:186578269-186578291 CCCAATGCAGTAGACTTGAGTCA No data
Right 985114601 4:186578317-186578339 GCCCATCAACCAGAAGAGGACGG No data
985114591_985114597 -1 Left 985114591 4:186578269-186578291 CCCAATGCAGTAGACTTGAGTCA No data
Right 985114597 4:186578291-186578313 AAAGTGGGGATTGCGGCGACAGG No data
985114591_985114605 29 Left 985114591 4:186578269-186578291 CCCAATGCAGTAGACTTGAGTCA No data
Right 985114605 4:186578321-186578343 ATCAACCAGAAGAGGACGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985114591 Original CRISPR TGACTCAAGTCTACTGCATT GGG (reversed) Intergenic
No off target data available for this crispr