ID: 985114592

View in Genome Browser
Species Human (GRCh38)
Location 4:186578270-186578292
Sequence TTGACTCAAGTCTACTGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985114592_985114603 25 Left 985114592 4:186578270-186578292 CCAATGCAGTAGACTTGAGTCAA No data
Right 985114603 4:186578318-186578340 CCCATCAACCAGAAGAGGACGGG No data
985114592_985114597 -2 Left 985114592 4:186578270-186578292 CCAATGCAGTAGACTTGAGTCAA No data
Right 985114597 4:186578291-186578313 AAAGTGGGGATTGCGGCGACAGG No data
985114592_985114601 24 Left 985114592 4:186578270-186578292 CCAATGCAGTAGACTTGAGTCAA No data
Right 985114601 4:186578317-186578339 GCCCATCAACCAGAAGAGGACGG No data
985114592_985114600 20 Left 985114592 4:186578270-186578292 CCAATGCAGTAGACTTGAGTCAA No data
Right 985114600 4:186578313-186578335 GGGAGCCCATCAACCAGAAGAGG No data
985114592_985114605 28 Left 985114592 4:186578270-186578292 CCAATGCAGTAGACTTGAGTCAA No data
Right 985114605 4:186578321-186578343 ATCAACCAGAAGAGGACGGGAGG No data
985114592_985114599 0 Left 985114592 4:186578270-186578292 CCAATGCAGTAGACTTGAGTCAA No data
Right 985114599 4:186578293-186578315 AGTGGGGATTGCGGCGACAGGGG No data
985114592_985114596 -9 Left 985114592 4:186578270-186578292 CCAATGCAGTAGACTTGAGTCAA No data
Right 985114596 4:186578284-186578306 TTGAGTCAAAGTGGGGATTGCGG No data
985114592_985114598 -1 Left 985114592 4:186578270-186578292 CCAATGCAGTAGACTTGAGTCAA No data
Right 985114598 4:186578292-186578314 AAGTGGGGATTGCGGCGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985114592 Original CRISPR TTGACTCAAGTCTACTGCAT TGG (reversed) Intergenic
No off target data available for this crispr