ID: 985114597

View in Genome Browser
Species Human (GRCh38)
Location 4:186578291-186578313
Sequence AAAGTGGGGATTGCGGCGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985114592_985114597 -2 Left 985114592 4:186578270-186578292 CCAATGCAGTAGACTTGAGTCAA No data
Right 985114597 4:186578291-186578313 AAAGTGGGGATTGCGGCGACAGG No data
985114589_985114597 26 Left 985114589 4:186578242-186578264 CCGCGTTGACCTTCAGAAAGCTA No data
Right 985114597 4:186578291-186578313 AAAGTGGGGATTGCGGCGACAGG No data
985114591_985114597 -1 Left 985114591 4:186578269-186578291 CCCAATGCAGTAGACTTGAGTCA No data
Right 985114597 4:186578291-186578313 AAAGTGGGGATTGCGGCGACAGG No data
985114590_985114597 17 Left 985114590 4:186578251-186578273 CCTTCAGAAAGCTACTGACCCAA No data
Right 985114597 4:186578291-186578313 AAAGTGGGGATTGCGGCGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985114597 Original CRISPR AAAGTGGGGATTGCGGCGAC AGG Intergenic
No off target data available for this crispr