ID: 985115872

View in Genome Browser
Species Human (GRCh38)
Location 4:186590093-186590115
Sequence GGTGCTTTATATAGTCTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985115872_985115874 7 Left 985115872 4:186590093-186590115 CCTTTTAGACTATATAAAGCACC 0: 1
1: 0
2: 0
3: 19
4: 163
Right 985115874 4:186590123-186590145 TAAAAAAAAACTTCCAATTTTGG 0: 1
1: 0
2: 10
3: 134
4: 1195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985115872 Original CRISPR GGTGCTTTATATAGTCTAAA AGG (reversed) Intronic