ID: 985117177

View in Genome Browser
Species Human (GRCh38)
Location 4:186603841-186603863
Sequence TCTGGAGAAGAATACTCAGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985117177_985117183 1 Left 985117177 4:186603841-186603863 CCACCTGAGTATTCTTCTCCAGA 0: 1
1: 0
2: 1
3: 15
4: 206
Right 985117183 4:186603865-186603887 GAGGTGATGAAAATCTCCAGGGG 0: 1
1: 0
2: 2
3: 14
4: 186
985117177_985117184 13 Left 985117177 4:186603841-186603863 CCACCTGAGTATTCTTCTCCAGA 0: 1
1: 0
2: 1
3: 15
4: 206
Right 985117184 4:186603877-186603899 ATCTCCAGGGGCAAAATCGCAGG 0: 1
1: 0
2: 1
3: 9
4: 90
985117177_985117182 0 Left 985117177 4:186603841-186603863 CCACCTGAGTATTCTTCTCCAGA 0: 1
1: 0
2: 1
3: 15
4: 206
Right 985117182 4:186603864-186603886 AGAGGTGATGAAAATCTCCAGGG 0: 1
1: 0
2: 3
3: 24
4: 280
985117177_985117181 -1 Left 985117177 4:186603841-186603863 CCACCTGAGTATTCTTCTCCAGA 0: 1
1: 0
2: 1
3: 15
4: 206
Right 985117181 4:186603863-186603885 AAGAGGTGATGAAAATCTCCAGG 0: 1
1: 0
2: 2
3: 35
4: 336
985117177_985117185 16 Left 985117177 4:186603841-186603863 CCACCTGAGTATTCTTCTCCAGA 0: 1
1: 0
2: 1
3: 15
4: 206
Right 985117185 4:186603880-186603902 TCCAGGGGCAAAATCGCAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985117177 Original CRISPR TCTGGAGAAGAATACTCAGG TGG (reversed) Exonic
902391195 1:16107933-16107955 TCTGGAAAAGAAAGATCAGGAGG + Intergenic
904869795 1:33609316-33609338 GCCAGAGAAGAATACTGAGGGGG - Intronic
905916247 1:41686396-41686418 TCTGGAGGAGATTACTTAAGTGG - Intronic
906245663 1:44272026-44272048 TCGGGAGAAGAGGAGTCAGGGGG - Intronic
906271744 1:44484649-44484671 TCTGGAGGAGGGTTCTCAGGTGG + Intronic
907105290 1:51877568-51877590 TCTGAAGGAAAATACTCAGGTGG + Intronic
908839723 1:68266804-68266826 TATGGAGAGTAATGCTCAGGAGG - Intergenic
908898865 1:68932342-68932364 TATGGAGAAGCAAAGTCAGGAGG + Intergenic
909358514 1:74735105-74735127 TTTGGAGAAGAATAGTTAAGTGG - Intronic
909409350 1:75331123-75331145 TCTGGATGAGAACACTTAGGAGG - Intronic
910088085 1:83428178-83428200 TCTGAATAAGAATACTCTGAGGG - Intergenic
910536177 1:88300412-88300434 TCTCTAGAAGAATCCTCAGAGGG + Intergenic
910809386 1:91220366-91220388 GCTGAAGAAGACAACTCAGGAGG + Intergenic
912686858 1:111774801-111774823 TCTGGAGAAAACTACTCCCGGGG + Intronic
913193724 1:116434988-116435010 ACTGCAGAATAATACTCAGCAGG - Intergenic
914707822 1:150185597-150185619 ACTGGAGAAGGATGCACAGGGGG + Intergenic
914869427 1:151460185-151460207 TCTGGGGAAGAATAAACAGGTGG - Intergenic
916282364 1:163065996-163066018 TCAGGTGATGAATACCCAGGGGG - Intergenic
916282376 1:163066071-163066093 TCAGGTGATGAATACCCAGGGGG - Intergenic
917392845 1:174557930-174557952 TCTGAAGAAGAGTGCTCAGGTGG - Intronic
917854191 1:179088096-179088118 TCTGGGGAACAATAGTCAGGAGG + Intronic
917955064 1:180087424-180087446 TCTGGAGAATGATGCTGAGGGGG + Intronic
921384402 1:214553935-214553957 TCTGGAGAAGAGTACTTTGATGG - Intergenic
923076374 1:230612435-230612457 ACCGGGGAAGAAAACTCAGGAGG + Intergenic
923375877 1:233362091-233362113 TCTGCAGCAGAAGTCTCAGGAGG + Exonic
924662695 1:246036375-246036397 TCTGGAGAAGGAGACTGCGGGGG - Intronic
1063334612 10:5199551-5199573 TCGGCAGAGGAATACACAGGTGG + Intronic
1065523972 10:26599145-26599167 CCTGGAGAATATTGCTCAGGTGG + Intergenic
1071406898 10:85344154-85344176 TCTTGGGAAGAACACCCAGGAGG - Intergenic
1071930673 10:90466183-90466205 TCTAGGGAAGAATTCCCAGGAGG - Intergenic
1074565839 10:114576975-114576997 TCTGGGGAAGAAGAAGCAGGTGG - Intronic
1078682822 11:13495496-13495518 TCTAGATAAGAATACTCTGCAGG + Intronic
1083380254 11:62261695-62261717 TCTAGAGAAGGACACTGAGGTGG + Intergenic
1084652125 11:70495526-70495548 ATTGGAGAAAAATACTCTGGGGG - Intronic
1087510236 11:99083142-99083164 TCAGGAGAAGAAAAAACAGGTGG - Intronic
1088190824 11:107226401-107226423 TGGGGAGAAGAATACTGAGGGGG - Intergenic
1089487713 11:118859983-118860005 TCTGGATGGGAATACTCAGTGGG - Intergenic
1090471021 11:126981411-126981433 TCTGGAGGAAAATGCTCAGGAGG + Intronic
1091672705 12:2464061-2464083 TCTGGAGAAGAACTTTCAGGAGG + Intronic
1094232016 12:28116638-28116660 TCTGAAGAAGAATAAGCTGGGGG + Intergenic
1094352867 12:29546063-29546085 TCTTGAGGAGAACACACAGGAGG + Intronic
1095461213 12:42446176-42446198 GCTGAAGAAGACAACTCAGGAGG + Exonic
1095597594 12:43977233-43977255 GCTGAAGAAGACAACTCAGGAGG - Intronic
1096717097 12:53498216-53498238 TCTGGACAGGAAGGCTCAGGGGG + Intronic
1096755776 12:53798280-53798302 CCTGGAGGAGAATACTGAGCAGG + Intergenic
1097204153 12:57306062-57306084 TCAGGATAAGAATATTAAGGTGG + Intronic
1099857005 12:88180576-88180598 GCTGAAGAAGATAACTCAGGAGG - Intronic
1100235027 12:92652518-92652540 TCAGGCTAAGAATATTCAGGAGG - Intergenic
1100662665 12:96717088-96717110 TCTAGAGGAGAACACTCATGTGG + Intronic
1101109255 12:101469848-101469870 TAAGGAGAAGAAAACTGAGGTGG + Intergenic
1101605277 12:106243745-106243767 TCTGGAGAACAAGAGACAGGTGG + Intronic
1101788060 12:107903575-107903597 TCTGGGGAAGGATTCTCAGAAGG + Intergenic
1104145877 12:126033231-126033253 GCTGAAGAAGACAACTCAGGAGG + Intergenic
1104225740 12:126831443-126831465 TATTGAGATGAATACTCTGGAGG - Intergenic
1109454604 13:62567883-62567905 CTTGGAGAAGAGTACTCAGAGGG + Intergenic
1109590113 13:64468125-64468147 TCTGTAAAAGGAGACTCAGGTGG + Intergenic
1110187738 13:72694406-72694428 TTTGGAGAGGAATTCTGAGGAGG - Intergenic
1110269822 13:73576678-73576700 TGTGGAGAATAATACACAGAGGG - Intergenic
1110918527 13:81054584-81054606 TTTTGAGAAGAATACACAGGAGG + Intergenic
1112206598 13:97329969-97329991 TCTAGAGAAGAATGCTGAGAAGG - Intronic
1113239919 13:108326117-108326139 TATGGATAAGAAAGCTCAGGGGG - Intergenic
1115592733 14:34879742-34879764 ACTGGACAAGGAGACTCAGGAGG - Intergenic
1115772390 14:36678389-36678411 TCAGGAGAAGAATAAGCAGAAGG + Exonic
1116161010 14:41266484-41266506 ACTGAAGAAAAATATTCAGGTGG - Intergenic
1117433541 14:55695098-55695120 TGTGGAGCAGAATACCCAAGAGG + Intronic
1117485341 14:56191395-56191417 ACTCGAGTAGAATCCTCAGGTGG + Intronic
1121956515 14:98218336-98218358 TCTGGGGAAGAGAACTCAGTTGG + Intergenic
1125059318 15:35400063-35400085 TCTGGAAAAGATTCTTCAGGAGG + Intronic
1126543169 15:49844017-49844039 GCTGAAGAAGAAAACTCAGGAGG + Intergenic
1127389500 15:58494031-58494053 GCTGGAGAATAATGCTCATGAGG + Intronic
1128304713 15:66590559-66590581 GCTGGAAAAGAAAACTGAGGGGG - Intronic
1129305722 15:74660082-74660104 TATGGATGAGACTACTCAGGAGG + Intronic
1131373319 15:91902756-91902778 TCTAGAGAGGAAAACTCATGGGG + Intronic
1131552681 15:93371776-93371798 CCTGAAGAAGAAAACCCAGGAGG + Intergenic
1135608360 16:23842301-23842323 TATGGTGAAGAATAATGAGGTGG + Intronic
1137417907 16:48301925-48301947 TCAGAAGAAGACTAATCAGGAGG - Intronic
1140225614 16:73074178-73074200 TCTGGAGAATAATACGAAGGAGG + Intergenic
1141753809 16:85977965-85977987 TATGCAGAAAGATACTCAGGTGG - Intergenic
1141761139 16:86029412-86029434 TCTGGAGGAGGCTACTCTGGAGG + Intergenic
1143522847 17:7455356-7455378 CCTGGAGAAGAACAGTGAGGGGG - Exonic
1143834380 17:9678476-9678498 TGTGGTGATGCATACTCAGGAGG - Intronic
1143992104 17:10974582-10974604 TTTGATGAAGAATAGTCAGGAGG - Intergenic
1146958593 17:36952912-36952934 TCTGGAGATGAAGATTCAGAGGG + Exonic
1147458923 17:40556208-40556230 TCTGGTTCAGAATTCTCAGGTGG - Intronic
1149094112 17:52819892-52819914 TTTGGAGAAGAATACCGTGGAGG - Intergenic
1151318509 17:73338454-73338476 TCTGGAAAAATAAACTCAGGAGG + Exonic
1151364002 17:73605389-73605411 TGTGGAGAAGAAAGCACAGGGGG + Intronic
1153380759 18:4436581-4436603 TCTAGAGATGGATACTGAGGTGG + Intronic
1153468850 18:5419788-5419810 TCCGGAGAAGAAGGCTGAGGAGG - Exonic
1160482293 18:79252894-79252916 TCTTGAGTAGAATCCTCATGGGG + Intronic
1164295384 19:23905097-23905119 GCTGAAGAAGACAACTCAGGAGG + Intergenic
1165481353 19:36066289-36066311 TGTGGAGGAGAAGAATCAGGTGG + Exonic
1165853723 19:38867299-38867321 TGTGGGGAAGAATACTCCGCAGG - Intergenic
1166595212 19:44041767-44041789 TCAGGGGAAGAATACTGATGAGG - Intergenic
925735603 2:6960591-6960613 TAGAGAGAAGGATACTCAGGTGG + Intronic
927739174 2:25552137-25552159 ACTGGAGAAGATAACTGAGGAGG - Intronic
929832319 2:45357066-45357088 CCAGGAGAAGAACACTGAGGAGG - Intergenic
931755928 2:65374597-65374619 CCTGGATGAGAATTCTCAGGTGG + Intronic
937075749 2:119105144-119105166 AGTGGAGAAGAACAATCAGGAGG - Intergenic
938171752 2:129084199-129084221 CCTGGAGAAGAACACACAGCAGG - Intergenic
938620927 2:133052372-133052394 TCTAGAGAAGTATATTAAGGTGG + Intronic
938715843 2:134021101-134021123 TGTGCAGAAGCATACTCCGGTGG + Intergenic
940159317 2:150694068-150694090 CCTGGAAAAGAAGACTCCGGGGG + Intergenic
941186945 2:162329028-162329050 TCAGCAGAAGAATACACAGGCGG - Intronic
942093600 2:172517426-172517448 GCTGAAGAAGACAACTCAGGAGG + Intergenic
943447923 2:188012526-188012548 ACTGTAGAAGCATACACAGGAGG + Intergenic
947555949 2:231093359-231093381 GCTGAAGAAGACAACTCAGGAGG - Intronic
948013958 2:234672699-234672721 CCTGGAGAAAAAAACTCACGTGG + Intergenic
948372465 2:237498306-237498328 TCTGGAGAGAAATACTGAGCAGG - Intronic
1168778531 20:468800-468822 GCTGAAGAAGACAACTCAGGAGG - Intergenic
1168842810 20:920682-920704 CCTGGAGTAGAATGATCAGGAGG + Intergenic
1173029867 20:39345863-39345885 TCTTGAGATTAATACTTAGGTGG - Intergenic
1174821053 20:53726761-53726783 TCTGGATAAGAATCCCCAGTAGG + Intergenic
1178009568 21:28267973-28267995 TCTGGAGAGGAGTACTGAGTAGG + Intergenic
1178203650 21:30438220-30438242 TCAGTAGAAGAATACTCTGAGGG - Intergenic
1180148719 21:45936630-45936652 CCTGGAGGAAAAGACTCAGGAGG - Intronic
1180882210 22:19213397-19213419 TCTGGAAAACAATAGTGAGGCGG + Intronic
952258382 3:31714885-31714907 TCTGGGGAAGAACACTCTGGTGG - Intronic
953363821 3:42324847-42324869 TCTGGAGAAGCATAAGCAAGTGG - Intergenic
956511647 3:69999773-69999795 TCCGGGGAAGAAGACACAGGTGG + Intergenic
957133003 3:76246597-76246619 TCTAGGGAATAATACTAAGGTGG - Intronic
957166364 3:76678715-76678737 TCTGGAGACAAGTACTTAGGTGG + Intronic
957303601 3:78426456-78426478 GCTGGAAAATTATACTCAGGAGG - Intergenic
958121790 3:89299189-89299211 TTTGAACAAGAATAATCAGGAGG + Intronic
961332421 3:126150507-126150529 GCTGGTGAAGAATATTCAGCTGG - Exonic
962912403 3:139864968-139864990 TCTGGAGATGAGTAGGCAGGAGG - Intergenic
964466661 3:157000143-157000165 TGAAGAGAAGAATACTGAGGGGG - Intronic
965160186 3:165123303-165123325 TCTGGAGGAAGACACTCAGGAGG - Intergenic
967066344 3:185920384-185920406 TCTGGGGGAGGAGACTCAGGTGG + Intronic
967180527 3:186899206-186899228 TCTGAAAAAGAGTACTCAGTGGG - Intergenic
968466778 4:755875-755897 TCTGAAGAAGAAAAATGAGGAGG - Intronic
969759468 4:9171565-9171587 CCTGGAGAAGAAAACACATGAGG + Exonic
971082490 4:23230245-23230267 TATAGAGAAAAATACTCAGGTGG + Intergenic
971735659 4:30447115-30447137 TGTGAAGAAGCATACACAGGAGG + Intergenic
973801252 4:54481176-54481198 TGAAGAGAAGAATATTCAGGCGG + Intergenic
974615975 4:64283272-64283294 GATGGAGATTAATACTCAGGAGG - Intronic
975220305 4:71806360-71806382 GCTGAAGAAGACAACTCAGGAGG - Intergenic
976681942 4:87767477-87767499 TTTAGAGAAGAACATTCAGGTGG + Intergenic
982924217 4:161315624-161315646 ACTGAAGAAAAATATTCAGGTGG - Intergenic
983008657 4:162518245-162518267 TCTAGAGCACAATTCTCAGGCGG - Intergenic
983364889 4:166773959-166773981 TCTCTGGAAGAAAACTCAGGAGG + Intronic
985117177 4:186603841-186603863 TCTGGAGAAGAATACTCAGGTGG - Exonic
985618447 5:938501-938523 TCAGGAGAGGAAGGCTCAGGGGG + Intergenic
985950005 5:3215685-3215707 TCTGGAGAAGAGTCCTGTGGAGG + Intergenic
987715460 5:21563586-21563608 TCTGTAGAAAATTTCTCAGGAGG - Intergenic
990416749 5:55594273-55594295 TATGGAGATGAATACTCTGAAGG - Intergenic
992559963 5:77941578-77941600 TCTGGGGAAGAATACCATGGAGG - Intergenic
994939156 5:106298440-106298462 TCTGGGCAAATATACTCAGGAGG - Intergenic
996058303 5:119004419-119004441 TGTGGAGTAGAAAACTCAGTAGG - Intergenic
998023932 5:138796804-138796826 TTTGCAGAAGCATATTCAGGTGG + Intronic
998451232 5:142235970-142235992 TCTGGAGCAGAACACTCAGGCGG + Intergenic
998783194 5:145681088-145681110 ACTGGAAAAAAGTACTCAGGGGG + Intronic
999645324 5:153711959-153711981 TCAGGAGAAGAAGTCTAAGGCGG + Intronic
1000065181 5:157688077-157688099 TATGGAAAAAAATGCTCAGGAGG + Intergenic
1000174761 5:158740803-158740825 TCTAGAGTATAATAGTCAGGGGG - Intronic
1000809563 5:165844530-165844552 TCTGGAGAAAAATAATCAAAAGG + Intergenic
1000828498 5:166075110-166075132 TCTGGAGAACAGTAAACAGGAGG - Intergenic
1002492437 5:179588207-179588229 AGTGGAGAGGAATTCTCAGGGGG + Intronic
1003186461 6:3835574-3835596 TCTAGAGAAGAAGCCACAGGAGG + Intergenic
1007159026 6:39774118-39774140 TCTGGAGAAGACAAGTAAGGAGG - Intergenic
1009001264 6:57718458-57718480 TCTGTAGAAAATTTCTCAGGAGG + Intergenic
1010840359 6:80642399-80642421 TCTGGAGAATAATCCTAATGGGG + Intergenic
1010967656 6:82230445-82230467 TCTGGAGAAGAATATTATTGGGG + Intronic
1012303531 6:97620620-97620642 TCCTGACAAGAATACTGAGGAGG + Intergenic
1013426090 6:110013914-110013936 TGTGGAGAAGAAAAAACAGGGGG - Intergenic
1014013215 6:116500567-116500589 TCTAGAGAAGAATCCCCTGGTGG - Exonic
1018175908 6:161179133-161179155 ACTGAAGAACAAAACTCAGGGGG + Intronic
1018564978 6:165141795-165141817 TATGGAGAAGATTTCTCAAGAGG - Intergenic
1018770963 6:166971118-166971140 GCTGGTCAAGAATTCTCAGGAGG - Intergenic
1019692806 7:2426124-2426146 TGTGGGGACGAATATTCAGGGGG + Intronic
1023314355 7:38920152-38920174 GCTGGAGAAAAATACTTATGTGG + Intronic
1024268156 7:47622275-47622297 TCAGCAGAAGAAGACACAGGCGG - Intergenic
1024329705 7:48143708-48143730 GCTGGAGAAGATAACTCAGGAGG + Intergenic
1024532990 7:50408672-50408694 TCTGGGAAAGAGTACTCAAGGGG + Intergenic
1024689577 7:51784618-51784640 TATCCAGAAGAATATTCAGGAGG + Intergenic
1024947049 7:54819358-54819380 AATGGAGTAGACTACTCAGGAGG - Intergenic
1027304959 7:76884615-76884637 TCTGAATAAGAATACTCTGAGGG - Intergenic
1030160361 7:106502160-106502182 TCTGCAGAAGCAGAGTCAGGAGG - Intergenic
1031156728 7:118119516-118119538 GCTGAAGAAGACAACTCAGGAGG + Intergenic
1031536249 7:122936747-122936769 TCTGGAGACTAAGACTCAAGAGG - Intergenic
1033472383 7:141661709-141661731 TCTGGACACGAATTCTCTGGAGG - Exonic
1034544557 7:151781381-151781403 TCTGGAGAAGAACCCTTTGGAGG + Exonic
1039005137 8:33027812-33027834 TCTGAAGAAGAATAAACAGAAGG - Intergenic
1039615324 8:38950915-38950937 CCTGGAGAAGAAGCCACAGGTGG + Exonic
1039877302 8:41597896-41597918 TCTTGGGAAGAATACAAAGGTGG + Intronic
1041103967 8:54423969-54423991 TATGGAGAATAAAACTCAGCAGG + Intergenic
1041687593 8:60658626-60658648 CCTGGAGAAGAGTACAGAGGGGG - Intergenic
1043311005 8:78859455-78859477 TCAGCAGAAGAAGACACAGGCGG - Intergenic
1043594101 8:81864069-81864091 TCACCAGAAAAATACTCAGGTGG - Intergenic
1044137759 8:88608988-88609010 GCTGAAGAAGACAACTCAGGAGG - Intergenic
1046829183 8:118725264-118725286 TCCACAGAAGAATTCTCAGGTGG - Intergenic
1047571714 8:126105933-126105955 TCTTGACCAGAATACACAGGTGG - Intergenic
1048286786 8:133147699-133147721 TCTGGGGAAGAATTCCCAGAAGG - Intergenic
1054604675 9:67163426-67163448 ACTGCAGAAGAATACTTAGTTGG - Intergenic
1055018677 9:71646045-71646067 TGTGGAGAAGGAGACTGAGGGGG - Intergenic
1057200887 9:93139463-93139485 TCTGGTGCAGGATATTCAGGTGG - Intergenic
1057221228 9:93259036-93259058 GCTGGAGAGAAATACTGAGGTGG - Exonic
1057715907 9:97495715-97495737 TGTGGAGAAGAAACCTCTGGTGG + Exonic
1058263603 9:102870468-102870490 GCTGGTGAAGAATACACAGAAGG + Intergenic
1058646858 9:107139046-107139068 TCTTGAGAAGAACTCTCAGCTGG + Intergenic
1062179058 9:135180879-135180901 TCTGGAGAAGAAGCTGCAGGTGG - Intergenic
1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG + Intergenic
1189081471 X:37977467-37977489 TCTGGAAATGAATGGTCAGGGGG + Intronic
1189117160 X:38355040-38355062 TCTGGAGTAGTAAACTCACGTGG - Intronic
1190707834 X:53045402-53045424 TTTGGAGCTGATTACTCAGGTGG - Intergenic
1191634381 X:63360281-63360303 GCTGAAGAAGACAACTCAGGAGG - Intergenic
1192215306 X:69153801-69153823 TCTGGAGAAAAATAGTTAGCAGG - Intergenic
1192667516 X:73102818-73102840 TCAGGAGAACAATCCTAAGGGGG - Intergenic
1193351507 X:80469941-80469963 GCTGAAGAAGACAACTCAGGAGG + Intergenic
1193400511 X:81036783-81036805 TCAGCAGAGGAATACACAGGAGG - Intergenic
1194326833 X:92529126-92529148 TCTGGAGAAAAAAACACAGTAGG + Intronic
1195399454 X:104446191-104446213 TCTGGAGAAGACTAGTCCTGTGG + Intergenic
1195862333 X:109395417-109395439 TCTGGAGGGGCATGCTCAGGAGG + Exonic
1196122021 X:112061428-112061450 TCTGAGGAGGAATACTGAGGGGG + Intronic
1196471714 X:116036073-116036095 TCTGGAAAAGAAAAATCTGGAGG - Intergenic
1197383130 X:125769901-125769923 ACTGGATAACAATACTCATGGGG - Intergenic
1197957870 X:131972304-131972326 TCTGGAGAAGAGTAACCAAGGGG + Intergenic
1198964242 X:142210575-142210597 TCTGCAGAAGAAGACACAAGTGG + Intergenic
1199390354 X:147271045-147271067 GCTGAAGAAGACAACTCAGGAGG + Intergenic
1199618453 X:149677897-149677919 GCTGAAGAAGACAACTCAGGAGG - Intergenic
1199624189 X:149725352-149725374 GCTGAAGAAGACAACTCAGGAGG + Intergenic
1200635550 Y:5648335-5648357 TCTGGAGAAAAAAACACAGTAGG + Intronic
1201401794 Y:13611441-13611463 GCTGAAGAAGACTACTCAGGAGG + Intergenic