ID: 985117790

View in Genome Browser
Species Human (GRCh38)
Location 4:186608149-186608171
Sequence GAATCCACAAAGCTTAGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985117790_985117792 11 Left 985117790 4:186608149-186608171 CCATATCTAAGCTTTGTGGATTC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 985117792 4:186608183-186608205 TTGCAAATAGTTTCTTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985117790 Original CRISPR GAATCCACAAAGCTTAGATA TGG (reversed) Intronic
900718854 1:4162096-4162118 GATCCCGCAAAGATTAGATAAGG + Intergenic
903496228 1:23769427-23769449 TAATCCACAAGGCTCAGAGAAGG + Intergenic
903825107 1:26138957-26138979 ATATCCACAAAGCTTGGAGAAGG + Intergenic
904657451 1:32059891-32059913 GGATCCACTCAGCTGAGATATGG + Intronic
909537847 1:76758486-76758508 GAATGAACTAAGCTTGGATATGG - Intergenic
909662747 1:78101957-78101979 AAATCCATAAAGCTTTGATTTGG + Intronic
910817472 1:91307141-91307163 AAATCAACAAAGCTGAGATTTGG - Intronic
911737970 1:101358204-101358226 TGATCCACAAAGCTCAGTTAAGG - Intergenic
913292338 1:117285439-117285461 TAAACCACAAAGCTTAGAGTTGG + Intergenic
917667794 1:177242131-177242153 GAATCTACAAAACTCAGATGGGG - Intronic
923540246 1:234883549-234883571 GAACCCACAAAGATGACATAGGG - Intergenic
923868665 1:237967191-237967213 GAAACCAACAATCTTAGATATGG - Intergenic
1066990971 10:42513214-42513236 GACTCCCCAAAGCATATATAAGG - Intergenic
1068928416 10:62563811-62563833 GAATCTAAGAAGCATAGATATGG - Intronic
1070427388 10:76302746-76302768 AAATCCACAAAAATGAGATATGG + Intronic
1070559581 10:77556028-77556050 GAATCGACACAGCTGACATATGG + Intronic
1075283162 10:121158758-121158780 GAATCCACACAGCTTCAAGAGGG - Intergenic
1077967109 11:7146655-7146677 GGAGCCAGAAAGCTTAAATAGGG - Intergenic
1080991992 11:37547373-37547395 GATTCCACAGAGCTAAGGTAGGG + Intergenic
1085189674 11:74608078-74608100 GAACCCATAAAGCATAGATCAGG - Intronic
1085213042 11:74799338-74799360 GAATCCAAGAACATTAGATATGG + Intronic
1085654077 11:78296367-78296389 GAATCAACAAATATTAAATAAGG - Intronic
1087744508 11:101927654-101927676 CAATCCTCAAAGGTTATATATGG - Intronic
1089601047 11:119615366-119615388 GAAGCCACAAAGCTTTGAAGTGG - Intergenic
1092334615 12:7619507-7619529 GAATCAACAAAGCTCAGAGTTGG - Intergenic
1093887925 12:24484832-24484854 GAATCCAAAAAGTTTAAATCTGG + Intergenic
1097061855 12:56290952-56290974 GAATCCAAACAGTTTAGATATGG + Intronic
1098329946 12:69342665-69342687 GCATCAACAAAGCTTGGAAAAGG - Intergenic
1099226496 12:79976157-79976179 GAATCCACTAACATTAGCTATGG + Intergenic
1100156635 12:91806835-91806857 GAACCCACAAAGATCAGAAAAGG + Intergenic
1100445415 12:94655657-94655679 TAATCCAAATGGCTTAGATAAGG + Intergenic
1101443127 12:104718413-104718435 GAATCCCTACTGCTTAGATACGG + Intronic
1106852944 13:33814994-33815016 AAATCCACAAAGTTCAGACATGG + Intergenic
1107040734 13:35944866-35944888 GAATGCACACAGATTATATACGG - Intronic
1107920922 13:45206404-45206426 GATTCCACAATGCCTAGATGGGG + Intronic
1110098308 13:71560680-71560702 GAATGTACAGAGCTTAGAGAGGG - Intronic
1114403233 14:22429531-22429553 GAATCCCTAAAGCTGAGCTAGGG - Intergenic
1119872996 14:78032799-78032821 GAATCCACACAGTTTGGATAGGG - Intergenic
1121006985 14:90496636-90496658 GAGTCCACCTAGCCTAGATAGGG - Intergenic
1121296893 14:92834652-92834674 GAATCCAGAGAGCTTAGAATAGG + Intronic
1126088455 15:45030739-45030761 GAATCCACACAGGATAGTTAAGG - Intronic
1128399919 15:67267750-67267772 GAATCAACATTGTTTAGATATGG + Intronic
1132368962 15:101279545-101279567 AAACCCACAAAACTTAGTTATGG + Intergenic
1133087257 16:3374669-3374691 GACATGACAAAGCTTAGATAAGG - Intronic
1136422520 16:30144332-30144354 TTATCCACAAAGCAAAGATATGG + Intergenic
1138431943 16:56974687-56974709 AAAACCACAAAGCTCAGAGAAGG + Intronic
1139156847 16:64453794-64453816 AAAGCCACAAAGCACAGATAGGG - Intergenic
1140316438 16:73902259-73902281 GAATCCCCAAACCTTAGAAGTGG - Intergenic
1141321700 16:83016609-83016631 GAATGCACAAGGCTTTGACAAGG - Intronic
1144436771 17:15249524-15249546 GAATCCACAAAAACTAGAGAGGG + Intronic
1147848352 17:43421412-43421434 GAAGTCACAAAGCTAAGATGTGG + Intergenic
1149144261 17:53470898-53470920 GAATCCAGTAAGCTTAAATGGGG + Intergenic
1151129449 17:71881405-71881427 CAATACACTAAGCTTAGATCTGG + Intergenic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1153095233 18:1393678-1393700 GAATCCACAAAACTTCTATGAGG + Intergenic
1153236982 18:2997609-2997631 CAATTCACAAACCTTACATATGG + Intronic
1153250781 18:3119381-3119403 GAAGCCACATAGCTTGGGTATGG + Intronic
1153648427 18:7216516-7216538 CAATTCACAAAGCCAAGATATGG - Intergenic
1154033244 18:10772473-10772495 GAATTCACAATGCTCAGATATGG + Intronic
1155610011 18:27656082-27656104 GAATCCAAATATCTCAGATAAGG + Intergenic
1156188758 18:34694791-34694813 GCATCCACAAAGCATATATTTGG + Intronic
1157786069 18:50483749-50483771 GAAGCCATAAATCTTAGGTATGG + Intergenic
1159056250 18:63467389-63467411 GAATTCACATTGCTTTGATAGGG - Intergenic
1159512057 18:69407509-69407531 GAGTCCACAAATTCTAGATAGGG + Intronic
1159591643 18:70341708-70341730 GAATCCAGAATACTCAGATATGG + Intronic
1163623337 19:18373708-18373730 GAATCCTCCAAGCATCGATAAGG - Intergenic
1166956439 19:46468556-46468578 GAATCCAGAAAGGTTTGATCTGG - Exonic
926955928 2:18299789-18299811 GAATTCACAAAGATTAAATGAGG + Intronic
929723980 2:44404148-44404170 TAATCCACAAAGCATATATTGGG - Intronic
931127014 2:59289417-59289439 TAATCCAAACAGCTTAGAGATGG - Intergenic
931177035 2:59864529-59864551 GCTTCCTCAAAGCTTAAATATGG + Intergenic
931910378 2:66892826-66892848 AATTCCACAAAGTTTAGTTATGG - Intergenic
933366110 2:81356314-81356336 GAAACCACACAGCTTAGCTCTGG - Intergenic
935106779 2:100052300-100052322 AAATCCACAAAACTTACATTGGG + Intronic
937292433 2:120789809-120789831 GAAGTCACACAGCTAAGATACGG - Intronic
941983024 2:171480537-171480559 GAATCCCGCATGCTTAGATATGG - Intronic
1169644701 20:7796995-7797017 GAATCCCCAAAATTTAGATCTGG + Intergenic
1172695790 20:36822071-36822093 GAGCCCACATGGCTTAGATAAGG - Intronic
1173979179 20:47209936-47209958 GGAACCACAAAGCAAAGATAAGG + Intronic
1177479686 21:21670055-21670077 GTATCCACAAAGCTTTGGTGTGG - Intergenic
1179315547 21:40240823-40240845 GCACCCAAGAAGCTTAGATATGG - Intronic
1181263215 22:21613627-21613649 TAAGCCACAAAGTTTTGATAGGG - Intronic
1181903250 22:26172335-26172357 GAATCCCTCAAGCTTAGATACGG - Intronic
1184806591 22:46798589-46798611 CACTCCACAAAGATGAGATAGGG - Intronic
1185277086 22:49954454-49954476 GAATCCACACAGCTTGGAGCTGG - Intergenic
949672934 3:6420773-6420795 GAATATAGCAAGCTTAGATAAGG + Intergenic
949923008 3:9018780-9018802 GAATGCACAAAGCATTTATAGGG + Intronic
952479152 3:33742789-33742811 GAAACTACAAAGCTCTGATAGGG - Intergenic
957417156 3:79919752-79919774 AAGGCCACAAAGCTTAGAAAAGG - Intergenic
964421849 3:156511573-156511595 GAATCCACAATACTTACAGATGG - Intronic
966797029 3:183725183-183725205 GTATCCACAAAGGATAAATAAGG + Intronic
968167062 3:196475219-196475241 GTATCAACATACCTTAGATACGG + Exonic
969717558 4:8875159-8875181 GAATCCACAGAGCATAGATCTGG + Intergenic
974744473 4:66053844-66053866 CAAGCTAAAAAGCTTAGATAAGG - Intergenic
976566209 4:86553363-86553385 GAGCCCACAAAGCTGAGAGAGGG + Intronic
978052238 4:104216003-104216025 GAATCAAGAATACTTAGATATGG - Intergenic
981642661 4:146963115-146963137 GAATCCACATAGCTAGGATTTGG - Intergenic
983358715 4:166700191-166700213 GAATCCAGAAATCTTGAATATGG + Intergenic
984669057 4:182461848-182461870 GAATTCACACAGCTAAGATAGGG + Intronic
985117790 4:186608149-186608171 GAATCCACAAAGCTTAGATATGG - Intronic
987200868 5:15576723-15576745 GAAACCATAAAGTTTAGATGAGG + Intronic
989366053 5:40657218-40657240 CAATTCACAAAGCAAAGATATGG + Intergenic
995781160 5:115776829-115776851 CATTCCCCAAAGCTTATATAGGG + Intergenic
996121612 5:119680112-119680134 GAATCCACATATCTTCCATACGG - Intergenic
996245177 5:121254649-121254671 CAATCCACAAAGCTCATAGAAGG + Intergenic
997052655 5:130400741-130400763 GAATCCATAAATCTTACAAAAGG + Intergenic
998479639 5:142452042-142452064 TAATCCCCAAAGCTAAGACATGG - Intergenic
1000723381 5:164736775-164736797 AAATCCACAAACCATAAATAAGG + Intergenic
1001847294 5:174933584-174933606 GAAGCCACTAAGCTTTGATATGG - Intergenic
1004626017 6:17377992-17378014 GAATTCATAAAGCATAGAGATGG - Intergenic
1008483800 6:52013918-52013940 GAACCCACAAAGCTCAGCCAGGG + Intronic
1008688307 6:53948176-53948198 AAATCAACAAAGTTTAGAAAGGG + Intronic
1012551273 6:100466556-100466578 GATTCCAGAAAGATCAGATAAGG + Intergenic
1022760616 7:33345568-33345590 GAATCCAAAAAACTTAGCTTAGG - Intronic
1024379493 7:48679549-48679571 GAATCTACAAAGCTAAAATAAGG - Intergenic
1030432657 7:109470276-109470298 GAAACCACAGACCTTAGATCAGG - Intergenic
1030502660 7:110379621-110379643 GAAACCACACTGCTTGGATATGG + Intergenic
1031733613 7:125329061-125329083 GAATCCGGAAGTCTTAGATAAGG + Intergenic
1032350199 7:131155334-131155356 CAATCCACAAAGATTAGAATGGG + Intronic
1034326159 7:150235524-150235546 GAATCCTCAAAGCTGAAATCTGG + Intergenic
1034767046 7:153733733-153733755 GAATCCTCAAAGCTGAAATCTGG - Intergenic
1034857276 7:154563507-154563529 GAATGCACATACCTTAGACAAGG + Intronic
1037074086 8:14691185-14691207 GAATCAACAATACTTCGATAAGG + Intronic
1039243175 8:35579177-35579199 GAATCCCCAAAGATTAACTAAGG - Intronic
1039585137 8:38700811-38700833 GAGGCCACAAAGCTGAGACATGG - Intergenic
1042443468 8:68855477-68855499 AAATTCACAAAGCATAAATAAGG + Intergenic
1043669631 8:82865879-82865901 GCATCCTCAAACCTTAGGTAAGG - Intergenic
1044219042 8:89648291-89648313 GACTCCACAAAGCTTTCAAAAGG - Intergenic
1045177869 8:99745125-99745147 AAATCCACATAACTTAGAAAAGG - Intronic
1046367934 8:113260540-113260562 GAATGCACAAAACTGAGACAAGG - Intronic
1057289577 9:93795251-93795273 AAATCCAAAAAGCTGAGTTAGGG - Intergenic
1057432839 9:95010662-95010684 GAATCCATAAAGCTTTTCTATGG - Intronic
1186284771 X:8031856-8031878 AAATCCATAAATCCTAGATATGG - Intergenic
1188584234 X:31752764-31752786 GAATGAACAAAGCTGAGCTAAGG - Intronic
1189271965 X:39758239-39758261 GAATCCACAAAGAGGAAATAGGG - Intergenic
1190649936 X:52559119-52559141 AAATCCACACTGCTTAGAGAGGG - Intergenic
1190995986 X:55609790-55609812 GAATACATAAACCTTAGATTAGG - Intergenic
1191969488 X:66797697-66797719 AAATACACAAAGTTTAGAAATGG - Intergenic
1194139511 X:90192476-90192498 TAATCCAAAAGGCTTACATAAGG - Intergenic
1197256612 X:124270046-124270068 GAATACAGAAAGCTAAGATTTGG + Intronic
1197748453 X:129948929-129948951 AAATACACAAAGCTCAGAAATGG + Intergenic
1199910825 X:152284956-152284978 AAAACAACAAAGCTTAGATAGGG + Intronic
1200485254 Y:3761422-3761444 TAATCCAAAAGGCTTACATAAGG - Intergenic