ID: 985122353

View in Genome Browser
Species Human (GRCh38)
Location 4:186656605-186656627
Sequence CAGGGTAAACTGATGATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985122351_985122353 -9 Left 985122351 4:186656591-186656613 CCGGCCTTGCTGAGCAGGGTAAA 0: 1
1: 0
2: 0
3: 9
4: 170
Right 985122353 4:186656605-186656627 CAGGGTAAACTGATGATGAATGG No data
985122349_985122353 -5 Left 985122349 4:186656587-186656609 CCTTCCGGCCTTGCTGAGCAGGG 0: 1
1: 0
2: 1
3: 11
4: 129
Right 985122353 4:186656605-186656627 CAGGGTAAACTGATGATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985122353 Original CRISPR CAGGGTAAACTGATGATGAA TGG Intronic
No off target data available for this crispr