ID: 985126373

View in Genome Browser
Species Human (GRCh38)
Location 4:186698752-186698774
Sequence CGGCTCCGCCACGGAGAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985126371_985126373 -8 Left 985126371 4:186698737-186698759 CCTGTTAGGGCAATGCGGCTCCG 0: 1
1: 0
2: 0
3: 1
4: 10
Right 985126373 4:186698752-186698774 CGGCTCCGCCACGGAGAGACTGG 0: 1
1: 0
2: 0
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985126373 Original CRISPR CGGCTCCGCCACGGAGAGAC TGG Intronic
900559443 1:3296462-3296484 CGCCTCCTCCACTGAGTGACAGG - Intronic
900596003 1:3480465-3480487 AGGCTCCGGGACGGAGAGACGGG + Exonic
900987231 1:6080283-6080305 GGGCTCCAGCACGGACAGACGGG - Intronic
904507308 1:30968474-30968496 TGGCTCCTCCACGGAGAACCTGG + Exonic
914422558 1:147542240-147542262 CCGCTCCTCCTCGGAGAGTCTGG - Intronic
923268548 1:232334864-232334886 CGGCTCAGCCACTGTGGGACAGG - Intergenic
1070678795 10:78434436-78434458 CAGCTCTGCAAAGGAGAGACAGG + Intergenic
1076614667 10:131747610-131747632 TGGCTCAGCCACGTACAGACGGG + Intergenic
1077477470 11:2797208-2797230 GGGCTGGGCCACGGAGAGGCCGG + Intronic
1077901192 11:6490332-6490354 CAGCTCCAGCACGGAGACACAGG + Intronic
1083436386 11:62646392-62646414 CGGATCTACCACGGGGAGACCGG + Intronic
1113800798 13:113085443-113085465 CGGCTCCACCCTGGAGGGACGGG - Intronic
1113971760 13:114196616-114196638 CAGCTCCCTCACGGACAGACGGG - Intergenic
1113981544 13:114281292-114281314 CGCCCCGGCCACGGAGAGCCTGG + Intergenic
1118351007 14:64972378-64972400 CGCCGCCGCCCCGGAGAGAGGGG + Intronic
1120168030 14:81220940-81220962 CGCCGCCGCCGCCGAGAGACAGG + Intronic
1123500599 15:20877992-20878014 CTGCTCCGCCCCGGAGCGCCGGG + Intergenic
1123557844 15:21451685-21451707 CTGCTCCGCCCCGGAGCGCCGGG + Intergenic
1123594071 15:21888966-21888988 CTGCTCCGCCCCGGAGCGCCGGG + Intergenic
1124014159 15:25862388-25862410 TGGCCCCGACACGGAGTGACAGG + Intronic
1131180221 15:90234116-90234138 GGGCTCCGCCCCGGAGCGTCGGG - Intronic
1202966195 15_KI270727v1_random:178857-178879 CTGCTCCGCCCCGGAGCGCCGGG + Intergenic
1132674180 16:1114850-1114872 CGGCTCTGCCAGCAAGAGACAGG - Intergenic
1136466276 16:30445940-30445962 CGACTCCGCCACCGAGAGGCGGG + Exonic
1142241729 16:88950481-88950503 CGGCACCGCCACAGAGGGTCAGG + Exonic
1142241747 16:88950549-88950571 CGGCACCGCCACAGAGGGTCAGG + Exonic
1142303941 16:89275162-89275184 GGGCTCCGCCAGGGAGGGAGGGG + Exonic
1145814171 17:27783578-27783600 CGGAGCTGCCACGGAGGGACTGG - Intronic
1145997698 17:29113940-29113962 GGGCTCCACCACGGGGAGAGGGG + Intronic
1147662264 17:42123033-42123055 CGGCTTCGCCCCGGAGGAACTGG + Exonic
1150263713 17:63818033-63818055 CGTCACAGTCACGGAGAGACTGG + Exonic
1152585099 17:81185807-81185829 AGGCTCTGCCAGGGAGAGAATGG + Intergenic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1162293020 19:9792896-9792918 CGGCTTCGCCACGTGGAGGCAGG - Intronic
1162911664 19:13851100-13851122 CTGCTGCCCCACGGAGGGACGGG + Intergenic
1164617168 19:29674178-29674200 CGCCTCCGCTACGGAGCGCCAGG + Exonic
1167037833 19:47004407-47004429 CGGCTCCGCCACGGGAGGGCTGG - Exonic
930021423 2:47004236-47004258 CAGCTCAGTCACTGAGAGACTGG - Intronic
939969558 2:148644610-148644632 CGGCAGCGCCGCGGAGAGAGTGG + Intronic
941819111 2:169827450-169827472 CGGCTCCTCCAGGGAGAGTGAGG - Intronic
947912587 2:233811227-233811249 AGGCCCTCCCACGGAGAGACAGG - Intronic
1181028202 22:20137672-20137694 CAGCTCCCCCAGGGAGAGGCAGG - Intronic
1182321323 22:29480073-29480095 CGGCTCCGCCGCAGTGAGAGGGG - Intergenic
1183594475 22:38802324-38802346 TGGCTCTGCTACTGAGAGACAGG - Intergenic
1184559420 22:45253322-45253344 TGGCTCCGCAACTGAAAGACTGG - Intergenic
950345349 3:12287894-12287916 CGGCTCCGCCGCGGGCAGGCGGG + Intronic
950580090 3:13856228-13856250 CAGCTCCGCCACTGACTGACTGG + Intronic
970332942 4:15003490-15003512 CGGCGCCGCCACGGAGGCGCGGG + Exonic
985126373 4:186698752-186698774 CGGCTCCGCCACGGAGAGACTGG + Intronic
992454293 5:76902052-76902074 CAGCTCAGCCACAGCGAGACAGG - Intronic
997853512 5:137353820-137353842 TGGGTCTGCCAGGGAGAGACTGG - Intronic
999721023 5:154399353-154399375 CAACTCTGCCACGGAGAGACAGG - Intronic
1002309576 5:178306460-178306482 CGGCTCTGCCAAGGAAGGACAGG + Intronic
1016900538 6:149096816-149096838 CTGCCCAGCCAAGGAGAGACAGG + Intergenic
1019925901 7:4191645-4191667 CTGCTCCGCCAGGGAGAGGGAGG + Intronic
1021382447 7:19984144-19984166 CAGCTCAGCCACAGAAAGACAGG - Intergenic
1029640624 7:101817017-101817039 GGGGTCCGCCACGGAGGAACAGG - Intronic
1047329481 8:123873410-123873432 AGGCTCCTCCATGGAGAAACAGG - Intronic
1055030702 9:71769208-71769230 AGGCTCAGCCAGGGAGTGACAGG - Intronic
1061727579 9:132589932-132589954 CGCCCCCGCCAGGGAGAGAAGGG + Exonic
1189532619 X:41902015-41902037 CGGATCCGCCAGGGTGAGTCTGG + Intronic
1196707220 X:118727286-118727308 CGGCTCCGCCACGCGGAGGGAGG + Intergenic
1198766750 X:140088016-140088038 CAGCTCCGCCCCTGAGAAACAGG - Intergenic
1199336048 X:146620079-146620101 GGGCTCCGCCAGGGAGGGAGGGG + Intergenic