ID: 985127387

View in Genome Browser
Species Human (GRCh38)
Location 4:186708338-186708360
Sequence TACCCGTTCTCACCCTCATC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 67}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985127387 Original CRISPR TACCCGTTCTCACCCTCATC AGG Exonic
900779520 1:4608734-4608756 ATCCTGATCTCACCCTCATCTGG - Intergenic
906107907 1:43305677-43305699 TACCAGTTCTCTTCCTCCTCAGG - Intronic
917144008 1:171868297-171868319 CACCTCTTGTCACCCTCATCAGG - Intronic
918552152 1:185755720-185755742 AATCCCTTCTCACTCTCATCAGG - Intronic
919533193 1:198751475-198751497 CACTCTTTCTCACCCTCACCTGG + Intronic
923837413 1:237628024-237628046 TGCCCATTCTCACACTCAGCAGG - Exonic
923999626 1:239536007-239536029 TACCCTTTCACACCCTCAGCTGG - Intronic
1070152506 10:73813524-73813546 TCCCCATGCTGACCCTCATCTGG - Exonic
1073545144 10:104341328-104341350 TACCAGTTCACACCCTCATGTGG - Intergenic
1077919351 11:6631331-6631353 GTCCCATTCTCCCCCTCATCTGG + Exonic
1078944097 11:16044235-16044257 TACCTCTTCTCTCCCTCATTTGG - Intronic
1079224361 11:18592514-18592536 TACTAGTTCTCAGCCTTATCTGG + Intergenic
1080729079 11:34929857-34929879 TACCCTTTCTCTCTCTCAACTGG - Intronic
1083321665 11:61851472-61851494 TCCCCGCTCTCACACTCATGGGG + Intronic
1083792009 11:64991880-64991902 TACCAGTCCTCACTCTCACCTGG + Intronic
1088401419 11:109424745-109424767 TCCCCATTCCCACCCTCAGCCGG + Exonic
1094250205 12:28351190-28351212 CACTCAGTCTCACCCTCATCTGG - Intronic
1096229505 12:49889322-49889344 TTCCCCTCCTCCCCCTCATCAGG + Intronic
1102170102 12:110835841-110835863 TACCCGTTCATAGCCTCAGCTGG + Intergenic
1104546186 12:129714959-129714981 TCCCCATCCTCACCCCCATCAGG + Intronic
1105478129 13:20747105-20747127 CACAGGTTATCACCCTCATCAGG + Intronic
1106489895 13:30211414-30211436 TAGCATTTCTCACCCTTATCAGG + Intronic
1108817855 13:54313638-54313660 TCCCCGTATTCACCCTTATCTGG - Intergenic
1111881249 13:93959988-93960010 TACCAGTTCTTTCCCTCATGAGG - Intronic
1117702027 14:58423715-58423737 TACCTGTTCTCACCATCAGGTGG - Intronic
1124006280 15:25797846-25797868 TACCCGATCTCACCCTGGGCTGG + Intronic
1125601761 15:40919255-40919277 CAGCCCTTCTCACCCTCACCAGG - Intergenic
1132066303 15:98733668-98733690 TACCACTTCTCATCTTCATCAGG - Intronic
1147528371 17:41249412-41249434 TTCCTGTTCTGACCATCATCTGG - Intronic
1162450080 19:10749233-10749255 TAGCCGTCCCCACCCTCATAGGG + Intronic
1162463833 19:10829419-10829441 TACCCCTTCTCTCCCTCCTCCGG - Intronic
1164391075 19:27821955-27821977 TACCACTTCTGCCCCTCATCAGG + Intergenic
1164493344 19:28735288-28735310 TGCCTGTGCTCACCCTCAGCAGG + Intergenic
1166840025 19:45691731-45691753 CGCCCGTTCTCAAACTCATCAGG + Intronic
1167048711 19:47066497-47066519 TGCCCGTGCCCACCCTCTTCGGG - Exonic
1168264843 19:55217083-55217105 TTCCCCTTCTCAGCCACATCTGG + Intergenic
925738793 2:6987035-6987057 CACGCGTTCTGACCCCCATCCGG - Intronic
927361497 2:22239904-22239926 TACCAGTGCTCACACTCTTCAGG - Intergenic
930174283 2:48285622-48285644 TATCGGTTCTCAACCTCAGCTGG - Intergenic
931810635 2:65851331-65851353 TACCCTTTTCCAACCTCATCAGG - Intergenic
937385572 2:121428872-121428894 TAACAGTTCCCACCCTCATGGGG - Intronic
948266203 2:236637015-236637037 TTCCCATTCTCATCCTCATGTGG + Intergenic
948967144 2:241391676-241391698 TTCCAGTTTTCAACCTCATCTGG + Intronic
1175465459 20:59187801-59187823 TCCCCATTCTCCCCCTCCTCTGG + Intergenic
1179716523 21:43291423-43291445 GACCCGTTCCCACCCTCCTGGGG + Intergenic
1180669392 22:17541674-17541696 CACACGTGCTCACCCGCATCAGG - Intronic
1184565179 22:45287499-45287521 TGCCCCTGCTCTCCCTCATCAGG - Intronic
952021963 3:29033869-29033891 TCCCCATTCTCACCTTCATTTGG + Intergenic
954300329 3:49697733-49697755 TACCCGCTCCCACCGTCCTCAGG + Intronic
959669849 3:108964108-108964130 TTCCTGTTCTCACTCTCTTCGGG + Intronic
964902428 3:161675611-161675633 TTCCCCTTGTGACCCTCATCTGG - Intergenic
985127387 4:186708338-186708360 TACCCGTTCTCACCCTCATCAGG + Exonic
989432375 5:41370945-41370967 GACCCCTTCTCTCCATCATCTGG + Intronic
991329879 5:65482597-65482619 CATCCAGTCTCACCCTCATCTGG - Intergenic
999239168 5:150117693-150117715 TAGTCGTTGTCACCCTCATTGGG + Exonic
999247658 5:150163799-150163821 TACCCTTCCACACCCTCATCAGG + Intergenic
1005883032 6:30074772-30074794 GACCCCTCCTCACCCTCAGCTGG + Intronic
1006947716 6:37796502-37796524 TGTTCTTTCTCACCCTCATCAGG + Intergenic
1008842662 6:55922235-55922257 TCCCTGTTCTCACAGTCATCAGG - Intergenic
1023039297 7:36158302-36158324 CACCCATCCTCTCCCTCATCAGG + Intronic
1025734022 7:64131343-64131365 CACCCTTTCTCGCCCTCACCAGG - Intronic
1026159843 7:67859261-67859283 CACCCTTTGTCACCCTCATCAGG - Intergenic
1026714017 7:72770520-72770542 TACACATTCTCACCATCATGTGG - Intronic
1030610189 7:111680552-111680574 AAGCCTTTCTCAGCCTCATCTGG + Intergenic
1036670635 8:10783634-10783656 TCCCTGTTCACAACCTCATCAGG - Intronic
1039468151 8:37797872-37797894 TCCCCGCTCTCACCCTTCTCAGG - Intronic
1040463616 8:47673932-47673954 TGCACGTTCTCACCTTCCTCTGG - Exonic
1041124256 8:54619057-54619079 AACCTCTTCTCATCCTCATCTGG - Intronic
1043799696 8:84592339-84592361 TAACCGTGCTCACTCTCTTCAGG + Intronic
1047180345 8:122581930-122581952 TACCCCATCTAATCCTCATCAGG + Intergenic
1048256660 8:132910119-132910141 TCCACGTTCTCACCTTCACCAGG + Intronic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic