ID: 985127803

View in Genome Browser
Species Human (GRCh38)
Location 4:186712785-186712807
Sequence GTCATCACAGCTGGGTGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985127803_985127807 20 Left 985127803 4:186712785-186712807 CCTCATCACCCAGCTGTGATGAC 0: 1
1: 0
2: 2
3: 17
4: 240
Right 985127807 4:186712828-186712850 GACATTGCCAAACACCCTCTAGG No data
985127803_985127808 21 Left 985127803 4:186712785-186712807 CCTCATCACCCAGCTGTGATGAC 0: 1
1: 0
2: 2
3: 17
4: 240
Right 985127808 4:186712829-186712851 ACATTGCCAAACACCCTCTAGGG 0: 1
1: 0
2: 4
3: 52
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985127803 Original CRISPR GTCATCACAGCTGGGTGATG AGG (reversed) Intronic
901339113 1:8479095-8479117 GTCATAACAGCTGGGCAAGGTGG + Intronic
901599441 1:10411408-10411430 GTCCTGACAGGTGGGAGATGAGG + Exonic
903301425 1:22381091-22381113 GTCATGACAGCTGGGTGCAGTGG + Intergenic
903608939 1:24595890-24595912 GTCATCACAACTGCCTTATGTGG - Intronic
905850737 1:41272752-41272774 GACATCACAACTGGCTGGTGAGG + Intergenic
908684829 1:66704440-66704462 GTCAACACTGATGGGAGATGTGG + Intronic
909006760 1:70285480-70285502 GTCATTATAGCTGGGTGCAGTGG - Intronic
909483788 1:76152383-76152405 GTCCTGCCAGGTGGGTGATGAGG + Intronic
910860723 1:91740344-91740366 GTAATCCCAGCTGGGTGTGGTGG - Intronic
912192717 1:107358778-107358800 GTCCTCACAGCAGGGTGTTATGG - Intronic
913490910 1:119379136-119379158 GTCATCACATCTTGTTGCTGGGG - Intronic
917042830 1:170825214-170825236 CTAATCACAGCTGGGTGTGGTGG + Intergenic
917536396 1:175877510-175877532 GTCAGCACAGCTGTGAGAAGAGG - Intergenic
919904762 1:202070585-202070607 GTGATCACAGCTGGTTGCTCAGG + Intergenic
921296275 1:213706424-213706446 GCCACCTCTGCTGGGTGATGAGG + Intergenic
922580981 1:226697847-226697869 GCCCTCACATCTGGGTGATAAGG + Intronic
922975855 1:229782825-229782847 GCCATCACAGCTAGGTGCAGTGG + Intergenic
923025587 1:230201342-230201364 CTCATCACAGCTGGTTGCCGTGG - Intronic
923803537 1:237233805-237233827 GTCATCGCAGCTGGGTGTGGTGG - Intronic
923831792 1:237566355-237566377 GTCAGACCAGCTGGGTGAAGTGG - Intronic
1065315524 10:24460020-24460042 GTCGGCACAGCAGGGTGATGGGG - Intronic
1066122964 10:32309330-32309352 ATAATCACATCAGGGTGATGGGG - Intronic
1066349483 10:34624316-34624338 TTCCTCACAGCTGTGGGATGAGG - Intronic
1067177021 10:43957325-43957347 GGCTTCACTGCTGTGTGATGTGG + Intergenic
1072240664 10:93492750-93492772 GTGATCACAGCTAAGTGCTGAGG + Intergenic
1073317182 10:102591211-102591233 GTGATCTCTGCTGGGTGCTGTGG + Intronic
1077222560 11:1424130-1424152 CACATCACAGCTGGAGGATGTGG - Intronic
1077863539 11:6204142-6204164 GTCATCGGAGCTGGCTGAGGTGG - Intergenic
1078088109 11:8246889-8246911 TTCATCCCAGCAGGGGGATGAGG - Intronic
1079417686 11:20254799-20254821 GTCATCACAACTGGGGGACAGGG - Intergenic
1080159922 11:29161264-29161286 GTAATCACAGCTTGGAGATGAGG + Intergenic
1081111721 11:39143644-39143666 GCCACCACAGCTGGGTGTGGTGG + Intergenic
1083192035 11:61059059-61059081 GTCGTCACAGCCGGGTGCAGTGG + Intergenic
1083558212 11:63649429-63649451 GAAATCACAGCTGGGTGTGGTGG - Intronic
1083618293 11:64036814-64036836 GTCTTGAGAGCTGGGGGATGGGG - Intronic
1084473392 11:69375858-69375880 GTCAGCACGTCTGGGTGATTTGG + Intergenic
1085528235 11:77176290-77176312 TTCATCACATCTTGCTGATGAGG - Intronic
1085539614 11:77254312-77254334 CTGATCTCAGCTGGGGGATGAGG + Intronic
1088184074 11:107144125-107144147 GTCATCACAGCCCTGTGCTGAGG + Intergenic
1089529289 11:119116238-119116260 GTCCTCAGAGCTGGGGGCTGGGG - Exonic
1090769976 11:129911386-129911408 TTCAGCACAGGTGGGTGAAGAGG + Intronic
1091636180 12:2198530-2198552 GTCCTCACAATTTGGTGATGTGG - Intronic
1092039254 12:5369108-5369130 GTCATCCCCGCTGGGTCGTGAGG + Intergenic
1092165331 12:6338915-6338937 GGCATCTCAGATGGGTGCTGTGG - Intronic
1093886551 12:24468054-24468076 ATCATAACAACTGGGAGATGAGG + Intergenic
1095648653 12:44580427-44580449 GTCATTCCAGCTGGGTGCGGTGG + Intronic
1099221033 12:79914660-79914682 GTCATCAATGGTGGCTGATGGGG - Intronic
1101565281 12:105899094-105899116 GTTGTCACAACTGGGGGATGTGG + Intergenic
1102471789 12:113163499-113163521 GGCAGGACAGCTGGGTGAGGAGG + Intronic
1102550969 12:113692018-113692040 GTCATCTCATCTGGAAGATGAGG - Intergenic
1103707763 12:122887989-122888011 GTCATCAGAGCTGGGTGTGGTGG - Intronic
1104479790 12:129097335-129097357 GTCATAAAAGCTGTGTCATGGGG - Intronic
1105501340 13:20975277-20975299 AGCAGCACAGCTTGGTGATGAGG + Exonic
1105820742 13:24078770-24078792 GTTATCCCAGTTGTGTGATGGGG + Intronic
1108368800 13:49746325-49746347 GTATTCACAGCTGGGTGTGGTGG + Intronic
1110846580 13:80196795-80196817 GTGATCACGGCTGGGGGAGGTGG - Intergenic
1111371399 13:87322540-87322562 GTCATTACAGCTGGACGATGCGG + Intergenic
1113008091 13:105730465-105730487 AGGAGCACAGCTGGGTGATGTGG + Intergenic
1114925081 14:27386069-27386091 GTCATCATGGCTGGGTGCTGGGG - Intergenic
1115417862 14:33157839-33157861 GTCATCTCATCTGTGAGATGGGG + Intronic
1116117220 14:40670155-40670177 GCCATCACAGGTGTGTGATGGGG - Intergenic
1116365757 14:44060866-44060888 ATCAGCACAGCTGAGTGATTTGG + Intergenic
1118864567 14:69692876-69692898 GTCATCTCCTCTGGGAGATGAGG + Intronic
1119701856 14:76761327-76761349 GCCCTGACAGCTGGGTGAGGAGG + Intergenic
1121016982 14:90554922-90554944 GTGATCACATCTGAATGATGTGG + Intronic
1121738432 14:96234845-96234867 GTCCTCACAGCTCAGTCATGGGG - Intronic
1122414262 14:101541275-101541297 GTCTGCACAGCTGGCTGGTGAGG + Intergenic
1122711921 14:103664961-103664983 CACATCACTGCTGGGTGCTGGGG + Intronic
1124370022 15:29099230-29099252 CCCAGCACAGGTGGGTGATGAGG - Intronic
1125182396 15:36892288-36892310 ATCATCATGGCTGGGTGGTGGGG + Exonic
1125915135 15:43479988-43480010 CTCATCACAGTTGGGTTTTGGGG - Exonic
1127301809 15:57662496-57662518 TTCTTATCAGCTGGGTGATGTGG + Intronic
1127501232 15:59555937-59555959 GTAATCAGAGCTGGGTGTGGTGG + Intergenic
1127520659 15:59740204-59740226 GTTATCACAACTGGGGGAGGAGG + Intergenic
1128392994 15:67195709-67195731 GTCATCTGAGCTGGCAGATGTGG - Intergenic
1128611383 15:69076365-69076387 GTTATCACAGCTGGGTATTGAGG + Intergenic
1129094451 15:73188840-73188862 GTAATCCCAGCTGGGAGCTGAGG + Intronic
1131405257 15:92159197-92159219 TTCATCTCAGCTGGGTGCGGTGG + Intronic
1132002843 15:98197231-98197253 GATGTCACAACTGGGTGATGCGG + Intergenic
1133382688 16:5344602-5344624 GTCCTCACAGCCGGGGGAGGGGG - Intergenic
1134045759 16:11099729-11099751 GTCCTCGCACCTGGGTGAGGAGG - Intronic
1135260071 16:20973014-20973036 GTCATGGCAGCTGGGCGAGGTGG - Intronic
1136135536 16:28254816-28254838 TTCATTACAGCTGGGTGTGGTGG - Intergenic
1136369790 16:29829198-29829220 GCCATCACACCTGGCCGATGAGG - Intronic
1141181043 16:81753694-81753716 GTCAGCACTGCTGGGTGCAGTGG - Intronic
1141393121 16:83681147-83681169 GCCCTCACAGCTGGGTGCTGGGG - Intronic
1143017926 17:3901352-3901374 GTCATCAGGGCTGGGTGCGGTGG - Intronic
1144268142 17:13591332-13591354 GTAATCAGAGCTGGGTGCGGTGG - Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1147443128 17:40459648-40459670 GTCAGCACCTCTGGGAGATGTGG + Intergenic
1147799468 17:43073042-43073064 GGCATCTCAGCTTGGTGAAGTGG + Intronic
1148641221 17:49189169-49189191 ATCACCTAAGCTGGGTGATGAGG + Intergenic
1148763770 17:50025868-50025890 AGCATCACAGCTGGGTGTGGTGG - Intergenic
1148958568 17:51374131-51374153 GTCATCACAGCTTGGGTAGGTGG + Intergenic
1149926865 17:60710102-60710124 GTCATCTCAGCTGGGTGCAGTGG - Intronic
1152032538 17:77853268-77853290 ATCATCACAGCTGGCTGATCTGG - Intergenic
1152678350 17:81653137-81653159 GTAAGCAGAGCTGGGGGATGGGG - Intronic
1152771600 17:82172991-82173013 GGCATCACAGCCTGGGGATGGGG - Intronic
1152999237 18:438523-438545 CTCATTCCAGCTGGGTGCTGTGG + Intronic
1153824604 18:8864055-8864077 GTCACCATTGCTGGGTCATGTGG - Intergenic
1155267618 18:24109049-24109071 AACATCCCAGCTGGGTGCTGTGG + Intronic
1157531914 18:48428588-48428610 GCTAACACAGCTGGGTGATCAGG - Intergenic
1158640568 18:59200160-59200182 GTGATCTCAGCTGGGTGTGGTGG + Intergenic
1158960597 18:62584757-62584779 GTCATCACAGCTGTGAAGTGGGG + Intronic
1160145046 18:76356888-76356910 GCCCTCACTGCTGGGTGATCAGG + Intergenic
1161407821 19:4100276-4100298 GCCACCACAGCTGGGTAATTTGG - Intronic
1161895147 19:7074666-7074688 GACATCTGAGCTGGGTGAGGTGG + Intronic
1164127832 19:22334661-22334683 GTCACATCAGCTGGGTGCTGAGG + Intergenic
1164150259 19:22544416-22544438 GGCACCATTGCTGGGTGATGTGG - Intergenic
1164643140 19:29840942-29840964 GTCAGCAGAGGTGGGGGATGAGG + Intergenic
1164911342 19:32014654-32014676 GTAAGGACAGCTGGGTGCTGTGG + Intergenic
1168293467 19:55368355-55368377 GTCAGCACACCTGGGAGCTGGGG + Exonic
1168391954 19:56016438-56016460 CTCAGCACAGCTGGGTGTGGTGG - Intronic
1168484706 19:56751136-56751158 GACATCACATCTCTGTGATGCGG - Intergenic
925176294 2:1786295-1786317 CACAACACAGCTGGGTAATGAGG - Intergenic
925873323 2:8289751-8289773 GACATCACAGGTGGAAGATGAGG - Intergenic
927687590 2:25182644-25182666 GTCTCCACAGCTGGGTGTGGTGG - Intergenic
927808012 2:26165229-26165251 GTCCTCATAGCTGGGTGCAGTGG - Intergenic
928087115 2:28352833-28352855 GTCGTCACAGCAGGATGGTGGGG + Intergenic
928917456 2:36488323-36488345 CCCATCACAGGTGGCTGATGAGG + Intronic
930710813 2:54549709-54549731 ATCATCCCAGCTGGGTAATCTGG + Intronic
931881053 2:66571395-66571417 ATCATCACTGTTGGGTGGTGAGG - Exonic
935967461 2:108495096-108495118 GTCATCAAAGCTGGGCGTGGTGG - Intronic
941901909 2:170687086-170687108 GTAATCCCAGCTGAGTGAGGGGG + Intergenic
942213282 2:173693014-173693036 GACAGCACAGCTGGCTGGTGAGG + Intergenic
944378695 2:199079981-199080003 GTCTTAACTGCTGGGTGATGTGG - Intergenic
947183589 2:227434085-227434107 GTGATCCCAGCTGGGTGTGGTGG - Intergenic
1168941892 20:1719874-1719896 GCAAGCACAGCTGGGTGTTGCGG + Intergenic
1169532469 20:6500609-6500631 GTCTTTACAGCTGGGTAATATGG + Intergenic
1169730125 20:8777429-8777451 GACATCCCAGCTGGGTGCGGTGG + Intronic
1171279565 20:23884283-23884305 GACATCAAAGCTGAGGGATGAGG - Intergenic
1171496447 20:25559524-25559546 GCCCTCCCAGCTGGGTGAGGTGG - Intronic
1172875652 20:38162813-38162835 GTGGTCAGTGCTGGGTGATGAGG + Intronic
1173670948 20:44798575-44798597 CTCATGGCAGCTGAGTGATGGGG - Intronic
1175061461 20:56247616-56247638 GTCATCACAGATTGTGGATGTGG - Intergenic
1175811692 20:61861845-61861867 GGCATCTTAGCTGGGTGCTGCGG + Intronic
1176014144 20:62920220-62920242 GTCATCCCAGCAGGGTACTGTGG + Intronic
1177137198 21:17318193-17318215 ATGATCACTGCTGGGGGATGGGG - Intergenic
1177242421 21:18476664-18476686 GTCATCACAGCCCCGTGCTGTGG + Intronic
1181077823 22:20393369-20393391 GTCATCCCATTTGGGAGATGAGG - Intergenic
1181277068 22:21693985-21694007 GCCATCACTGCTGGGGGTTGAGG + Intronic
1182323855 22:29496692-29496714 GTCATCTCAGCTGGATGTGGTGG + Intergenic
1183300103 22:37054661-37054683 CTCATGACAGCTCGGTGAGGTGG - Intronic
1183513376 22:38248898-38248920 AACAGCACAGCTGGATGATGGGG - Intronic
1184388015 22:44187242-44187264 GCCATCACAGCTGGGGGAAAGGG - Intronic
1184806759 22:46799825-46799847 GTCATCACAGCGGGGGCACGTGG + Intronic
949140381 3:626154-626176 GTTGTCACTGCTGGATGATGGGG + Intergenic
949226464 3:1700686-1700708 GTCACCACATCTGGATGAGGGGG - Intergenic
949235767 3:1806564-1806586 GACATCCCAGCTGGTAGATGGGG + Intergenic
950083670 3:10241120-10241142 CTCATTACAGCTGGGTGCAGTGG + Intronic
950107152 3:10395488-10395510 GCCATCACATCTGCATGATGAGG + Intronic
950150352 3:10682022-10682044 GGCATTAGAGCTGGGTCATGAGG + Intronic
950362818 3:12461954-12461976 ATCATCACAGCTGGTCTATGAGG + Intergenic
950539383 3:13600974-13600996 GTGATCACATCAGGGTGTTGAGG + Intronic
950694815 3:14690769-14690791 GCCATGACAGCTGGGTTGTGGGG + Intronic
951136400 3:19108180-19108202 GCCACCACAGCTGGGTGCAGTGG + Intergenic
954394661 3:50287186-50287208 GGCATCTCAGCTGGGTGCTTGGG - Exonic
955117920 3:56024346-56024368 GCCAACACAGTTGGGTGCTGCGG - Intronic
955725696 3:61930418-61930440 GTCTTCTCAGCAGTGTGATGAGG + Intronic
955949546 3:64228402-64228424 GTGAGCTCAGCTTGGTGATGAGG + Intronic
956655249 3:71543538-71543560 CACATCACAGCTTGGTGCTGGGG - Intronic
962257156 3:133880417-133880439 GTCATCACTGTTGGGTGTTACGG - Intronic
963643581 3:147886048-147886070 GTCATCACAGCTGGAAACTGTGG - Intergenic
963660761 3:148126047-148126069 GTAATCCCAGCTGGCTGAGGTGG - Intergenic
966239562 3:177741208-177741230 GTCATCAGTGCTGGGTGAGTTGG - Intergenic
967934568 3:194716533-194716555 GTGACCACAGCTGTGTGATTTGG - Intergenic
972355537 4:38276745-38276767 ATCATCTCAGCTGGGCGCTGTGG + Intergenic
972597326 4:40541447-40541469 GTCAACACTGCTGGGTGTGGTGG + Intronic
976339957 4:83935719-83935741 CTCGTCACAGCTCTGTGATGAGG + Intergenic
980130905 4:128814848-128814870 GTCCTCAGAGCTGGGTGCGGTGG - Intronic
981702941 4:147627036-147627058 GTCATCCAAGGTGGGTGCTGAGG + Intronic
982350357 4:154408762-154408784 CTGATCCCAACTGGGTGATGGGG - Intronic
982499808 4:156139095-156139117 GTCATCAAAGCTGGCAGAAGTGG + Intergenic
983200413 4:164854913-164854935 GTAATAACAGCTGGGTGCGGTGG + Intergenic
984428720 4:179621315-179621337 GTAATCCCAGCTGGGTAAGGGGG - Intergenic
985127803 4:186712785-186712807 GTCATCACAGCTGGGTGATGAGG - Intronic
985709441 5:1420026-1420048 GCCATCTCAGCTGGGGTATGAGG - Intronic
986111464 5:4723056-4723078 GGTATCACAGCTGGGTCACGTGG - Intergenic
986195150 5:5531598-5531620 GTCGGCACAGCTGGGGGAGGTGG - Intergenic
986520084 5:8605869-8605891 GACATCAGAGCTGGTGGATGAGG + Intergenic
992090541 5:73312391-73312413 CTCATCTCAGCTGGGTTAAGGGG - Intergenic
992659870 5:78948345-78948367 GTAATCATATCTGGGTAATGGGG - Intronic
995841844 5:116449649-116449671 GACATCACAGTTGGTTGCTGTGG + Intronic
997142292 5:131395383-131395405 GTCATCACAGCTTGAGGAGGGGG + Intronic
997709242 5:135990147-135990169 CTCATCACAGCTGGTTGTGGAGG + Intergenic
1002535460 5:179873302-179873324 CTTCCCACAGCTGGGTGATGCGG + Intronic
1003140178 6:3464735-3464757 GTCATCACATCTGGGTGCAGTGG - Intergenic
1003499293 6:6691072-6691094 ATCATGACACCTTGGTGATGGGG + Intergenic
1004431888 6:15552498-15552520 GACAGCACAGCTGGGTGCAGTGG + Intronic
1005413154 6:25572404-25572426 GACATCATAGCTGGGTGCAGTGG + Intronic
1008214914 6:48777447-48777469 GCCACCACTGCTGGGGGATGGGG - Intergenic
1011706684 6:90007631-90007653 AGCATCATATCTGGGTGATGGGG + Intronic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1015343985 6:132133916-132133938 GTGATCACAGCGGGGGGGTGAGG - Intergenic
1016778666 6:147934555-147934577 GTAATGACAGGTGGGTGACGTGG + Intergenic
1017474020 6:154770191-154770213 GTAATCTCAGCAGGGAGATGTGG + Intronic
1019807924 7:3142282-3142304 GACATGACAGATGGGTGGTGGGG + Intronic
1020588625 7:10105464-10105486 GTGATAACAGCTGGGTACTGTGG - Intergenic
1021008400 7:15429628-15429650 GTCATCACAGGTGTATGGTGTGG + Intronic
1022154492 7:27645667-27645689 GTCAGAACAGCCGGGTGAGGTGG - Intronic
1022484702 7:30769499-30769521 GTCTTCACAGCTGGAACATGAGG + Intronic
1022821187 7:33962545-33962567 GTTATCACAGCTGGAAGATATGG - Intronic
1024764180 7:52637209-52637231 ATCATCACAGCTTGATGATCTGG - Intergenic
1024955127 7:54910486-54910508 ATCAACACAGCTGAGTCATGGGG + Intergenic
1026582074 7:71626890-71626912 GTGGCCAAAGCTGGGTGATGGGG + Intronic
1026585028 7:71649056-71649078 GTGGTGACAGCTGGGTAATGGGG - Intronic
1028999148 7:97134732-97134754 ATCTTCTCAGCTGGGTGAGGTGG - Intronic
1029627947 7:101732104-101732126 GTCACCCCACCAGGGTGATGAGG + Intergenic
1030283411 7:107800205-107800227 CTCAGCACAGCTGGGTGCAGTGG + Intronic
1033682732 7:143611481-143611503 GCCAAAACAGCTGGGTGCTGTGG - Intergenic
1033701884 7:143846162-143846184 GCCAAAACAGCTGGGTGCTGTGG + Intergenic
1036600724 8:10258071-10258093 TTCATAACAGCTGGGGGATAGGG + Intronic
1037417344 8:18666336-18666358 GTTTACACAGCTGGGTGAGGTGG - Intronic
1037866742 8:22450154-22450176 GTCATCACAGCCGGGCGCGGTGG - Intronic
1038003691 8:23412098-23412120 TGCATCAGAGCTGGGTGTTGGGG - Intronic
1038324877 8:26565467-26565489 CTCATCACATCTTGATGATGTGG + Intronic
1038617954 8:29112743-29112765 GCCAGCACAGCTGGGAAATGGGG - Intronic
1039522991 8:38187733-38187755 GTTAGCCCAGCTGGGTGCTGTGG + Intronic
1039622750 8:39013787-39013809 CTCATAACAGCTGGGTGCAGTGG - Intronic
1040730562 8:50442113-50442135 TTCATCAAAACTGGGAGATGGGG - Intronic
1041187205 8:55313606-55313628 TTCATGCCAGCTGGTTGATGGGG - Intronic
1041231247 8:55755009-55755031 GTCTTCACGGCTGGGTGCAGTGG + Intronic
1042484350 8:69334357-69334379 GTCCTCACAGCTGAGTGAACGGG - Intergenic
1042989706 8:74625349-74625371 GTATTCACGGCTGGGTGCTGTGG - Intronic
1043488234 8:80720146-80720168 GGAGTCACATCTGGGTGATGGGG - Intronic
1044743326 8:95349645-95349667 GGCATCACAGCGTGGTGGTGAGG - Intergenic
1044764892 8:95560908-95560930 ATAATCACAGGTGGGTGAAGAGG - Intergenic
1046212113 8:111089674-111089696 GTGGTCAAAGCTGGTTGATGCGG - Intergenic
1048180290 8:132188173-132188195 GTCATCTCATCTGGGGAATGAGG + Intronic
1048441438 8:134462333-134462355 GTCAGCACAGCTGTATGATGCGG + Intergenic
1048529768 8:135236751-135236773 ATGATCCCAGCTGTGTGATGGGG + Intergenic
1049826291 8:144670931-144670953 GTCATCAGAGCTGGATTAGGTGG - Intergenic
1051120238 9:13744717-13744739 CTCTTCGCAGCTGGCTGATGGGG + Intergenic
1053556852 9:39146239-39146261 GTCAGCACAGCCAGGTGAGGAGG + Intronic
1053820963 9:41966517-41966539 GTCAGCACAGCCAGGTGAGGAGG + Intronic
1054089831 9:60834656-60834678 GTCAGCACAGCCAGGTGAGGAGG + Intergenic
1054111242 9:61110214-61110236 GTCAGCACAGCCAGGTGAGGAGG + Intergenic
1054609615 9:67220911-67220933 GTCAGCACAGCCAGGTGAGGAGG - Intergenic
1054865296 9:69994122-69994144 GTCATCACAGCAGGTCGTTGCGG + Intergenic
1055628018 9:78194537-78194559 GTTATCACAACTGGGAGAGGTGG - Intergenic
1058177442 9:101753546-101753568 GTCATCACAGCTGGGTTTACTGG + Intergenic
1058884391 9:109312515-109312537 GACAGCACAGCTGGGCGAGGGGG - Intronic
1059275663 9:113094809-113094831 GTCTTCACTGCTAGATGATGTGG + Intergenic
1061579735 9:131529662-131529684 GTCAGCACAGCTGGGTGCTGGGG + Intronic
1186180773 X:6970774-6970796 GTCAGAACAGCTGGGTGCAGTGG + Intergenic
1186515516 X:10163885-10163907 GTTATTACAACTGGGAGATGGGG - Intronic
1186976863 X:14917050-14917072 GTTGTCACAACTGGGGGATGGGG + Intronic
1187367669 X:18677850-18677872 GTCATCACAACTGGGTGGTGGGG - Intronic
1189388475 X:40556705-40556727 GTCATCTCAGCTGGGTGCGGTGG - Intergenic
1189725000 X:43959411-43959433 GTCATCAGTGCTGGGTGCTATGG - Intronic
1190093667 X:47462013-47462035 GTTTTTACAGCTGGGTGCTGTGG - Intronic
1192577815 X:72257031-72257053 GACATGATAGCTGGGTGTTGTGG + Intronic
1193561358 X:83021842-83021864 ATGGTCACTGCTGGGTGATGGGG - Intergenic
1194550326 X:95290459-95290481 GCCATCACAGCTGGAGGATGAGG - Intergenic
1198068628 X:133125338-133125360 TTTATCCCAGCTGGGTGCTGTGG - Intergenic
1198218221 X:134576249-134576271 GTCCTCCCAGCTGGGTGTGGTGG + Intronic
1199714489 X:150496720-150496742 GTCAGCAATGCTGGGTAATGAGG - Intronic
1201301736 Y:12511203-12511225 GACATCAAAGCTGTGTGTTGCGG + Intergenic
1202337391 Y:23826258-23826280 GTCATCCCAGGTGGGTCATTGGG + Intergenic
1202533375 Y:25843813-25843835 GTCATCCCAGGTGGGTCATTGGG - Intergenic