ID: 985128827

View in Genome Browser
Species Human (GRCh38)
Location 4:186722082-186722104
Sequence GCCCTATGGGAGGTCGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343509
Summary {0: 1, 1: 25, 2: 3382, 3: 100209, 4: 239892}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985128827_985128836 -4 Left 985128827 4:186722082-186722104 CCCGCCTCGACCTCCCATAGGGC 0: 1
1: 25
2: 3382
3: 100209
4: 239892
Right 985128836 4:186722101-186722123 GGGCTGGGTTTACAGGCGTGAGG 0: 1
1: 8
2: 1028
3: 2898
4: 3355
985128827_985128837 8 Left 985128827 4:186722082-186722104 CCCGCCTCGACCTCCCATAGGGC 0: 1
1: 25
2: 3382
3: 100209
4: 239892
Right 985128837 4:186722113-186722135 CAGGCGTGAGGCACTACGCCCGG 0: 3
1: 389
2: 20286
3: 98374
4: 182175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985128827 Original CRISPR GCCCTATGGGAGGTCGAGGC GGG (reversed) Intronic
Too many off-targets to display for this crispr