ID: 985129615

View in Genome Browser
Species Human (GRCh38)
Location 4:186726610-186726632
Sequence TGACAAACTTGGCTGCTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985129615_985129622 11 Left 985129615 4:186726610-186726632 CCCGGGAGCAGCCAAGTTTGTCA 0: 1
1: 0
2: 2
3: 10
4: 136
Right 985129622 4:186726644-186726666 GGCAGCCAGCCGCCGAGTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 79
985129615_985129624 19 Left 985129615 4:186726610-186726632 CCCGGGAGCAGCCAAGTTTGTCA 0: 1
1: 0
2: 2
3: 10
4: 136
Right 985129624 4:186726652-186726674 GCCGCCGAGTTGAGGAGTTGCGG 0: 1
1: 0
2: 0
3: 9
4: 65
985129615_985129627 26 Left 985129615 4:186726610-186726632 CCCGGGAGCAGCCAAGTTTGTCA 0: 1
1: 0
2: 2
3: 10
4: 136
Right 985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
985129615_985129619 -10 Left 985129615 4:186726610-186726632 CCCGGGAGCAGCCAAGTTTGTCA 0: 1
1: 0
2: 2
3: 10
4: 136
Right 985129619 4:186726623-186726645 AAGTTTGTCAGGACGTGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985129615 Original CRISPR TGACAAACTTGGCTGCTCCC GGG (reversed) Intronic
900500073 1:3000016-3000038 TTACAAACTGATCTGCTCCCGGG - Intergenic
900992099 1:6102759-6102781 TTGCAAACTTGGCTTCCCCCAGG - Exonic
904567371 1:31435744-31435766 TGGCCATCTTGGCTTCTCCCTGG - Intergenic
904790127 1:33013560-33013582 TGAAGAACTTTGCTACTCCCAGG + Intronic
912052270 1:105544237-105544259 TGACAATCTTTGGTGTTCCCTGG + Intergenic
920744477 1:208613577-208613599 TTGCAAACTTGCCTGCTCCCTGG - Intergenic
920757808 1:208751265-208751287 TGCCAAACTTGGCTGCACATTGG - Intergenic
1067015722 10:42755251-42755273 TGCCATACTTGGCTGCTGCCGGG - Intergenic
1068798387 10:61110131-61110153 TCACTAACATGGCTGCTTCCAGG + Intergenic
1072659750 10:97356520-97356542 TGACACAGGTGGGTGCTCCCGGG + Intronic
1073444496 10:103572449-103572471 TAAGACTCTTGGCTGCTCCCTGG + Intronic
1074755376 10:116620787-116620809 TAATAAACATTGCTGCTCCCAGG + Intergenic
1078001680 11:7501556-7501578 TGACATCACTGGCTGCTCCCAGG - Intronic
1084243274 11:67837355-67837377 TGTCAAACTTTGCTGCACCAAGG - Intergenic
1086930581 11:92688621-92688643 TTTCAAACTTGGCTGTGCCCTGG - Intronic
1090290994 11:125544668-125544690 TGTAAAACTTTGCTGCTTCCAGG - Intergenic
1095882791 12:47156282-47156304 TGACAATGTTGGCTGCTGCTGGG + Intronic
1096572730 12:52533089-52533111 TAACGCACTTGGCTTCTCCCTGG + Intergenic
1098968159 12:76817214-76817236 TGAGTAAATTGGCTGATCCCAGG + Intronic
1100891177 12:99127642-99127664 TTAGAAACTTGGCTGCACCAAGG + Intronic
1101660392 12:106759996-106760018 TGACAACAATGGCTGCTCCCTGG - Intronic
1102208002 12:111103898-111103920 TCACCACCTTGGCAGCTCCCAGG + Intronic
1102935995 12:116897560-116897582 TGTCAAACTTGGCTGCACGTTGG - Intergenic
1103357678 12:120333743-120333765 TCCCAAACTTGACTGATCCCTGG + Intergenic
1103541415 12:121669081-121669103 TGAGAAACTGGCCTGCCCCCGGG - Intronic
1105674961 13:22661233-22661255 TGACAAACTTGGCTACTTAGTGG + Intergenic
1111094273 13:83491118-83491140 GGAAAAAGTAGGCTGCTCCCAGG - Intergenic
1117131314 14:52689848-52689870 TTACAAAGTAGGCTGCTTCCAGG - Intronic
1119109797 14:71960823-71960845 TGGCAAACTTTGCCTCTCCCAGG + Intronic
1119267320 14:73270721-73270743 TGAGAAACTTGCCTGATACCTGG + Intronic
1120861682 14:89260526-89260548 GGACAAAGTGGGCTGCACCCAGG - Intronic
1125361941 15:38873672-38873694 TGACAATCTTGGCTTCCCCAGGG + Intergenic
1126706467 15:51410501-51410523 TGACAGACTTGGCTGAACCATGG - Intergenic
1126734157 15:51714692-51714714 TTGCAAACTTGGCTGCACGCTGG - Intronic
1127771187 15:62232113-62232135 TCACAGACATGGCTGTTCCCAGG - Intergenic
1128393921 15:67203905-67203927 TGAGAAACTTAGCTACTCCTGGG - Intronic
1128632356 15:69279804-69279826 TGTCAAACTTGCCTGCACACTGG + Intergenic
1130195226 15:81773087-81773109 GGACACACTGGCCTGCTCCCAGG + Intergenic
1132361707 15:101221415-101221437 GGGCAAGCTTGGCTCCTCCCGGG - Intronic
1132530473 16:445830-445852 GGACAGACCTGGCTGCTCCCTGG + Intronic
1135559760 16:23467157-23467179 TGAAAGGCTTGGTTGCTCCCAGG - Exonic
1136397860 16:30002849-30002871 GGACCAACTGGGCGGCTCCCAGG + Intronic
1138581952 16:57947421-57947443 TGAGGAACTTAGCTGCTGCCTGG - Intronic
1139400088 16:66674396-66674418 TGACCATCTGGGCTGCTCCTGGG - Intronic
1142122580 16:88394191-88394213 TGTCAAACTCCGCTCCTCCCAGG - Intergenic
1143909428 17:10235481-10235503 TGACAAATCTGGCTGCCCCATGG - Intergenic
1144465391 17:15493039-15493061 TGACAAAGATTGGTGCTCCCAGG - Intronic
1145066079 17:19762260-19762282 TGTCCAACATGGCTGCTCCAGGG - Intergenic
1145275740 17:21429114-21429136 AGACAAAGTTGGCTGCTTCTTGG - Intergenic
1145313588 17:21715022-21715044 AGACAAAGTTGGCTGCTTCTTGG - Intergenic
1145712031 17:26986999-26987021 AGACAAAGTTGGCTGCTTCTTGG - Intergenic
1146113015 17:30108761-30108783 TGACAAACTTTACTGCTCTGTGG + Intergenic
1146558318 17:33846696-33846718 TGAGAATCTTAGCTGCTCACAGG - Intronic
1149241438 17:54654767-54654789 AGAAAAACTTTGCTGATCCCTGG - Intergenic
1152656978 17:81524311-81524333 TGTCACAGCTGGCTGCTCCCTGG + Intergenic
1153481304 18:5549697-5549719 TGTTAAAAATGGCTGCTCCCTGG - Intronic
1153934877 18:9912849-9912871 AGACAAACTGTGCTGCTCCATGG + Intergenic
1156919791 18:42507647-42507669 TGACAAAATTGGCTGCCTCTTGG + Intergenic
1160264244 18:77325455-77325477 TGAAAAAGCTGGCTGCCCCCTGG + Intergenic
1160669085 19:348209-348231 TGTCAAACTTGGGAGCTGCCCGG - Intergenic
1163358036 19:16827590-16827612 TGACCAACCTGGCTGCTTCCTGG - Intergenic
1164806297 19:31119733-31119755 GGACAAACATGGCTGCTCCTTGG + Intergenic
925360421 2:3276967-3276989 TGACAAACAGGTTTGCTCCCTGG - Intronic
925477333 2:4232017-4232039 TGTCAATGGTGGCTGCTCCCAGG + Intergenic
927426177 2:22984151-22984173 TGGCCATCTTGGCTCCTCCCGGG - Intergenic
930609145 2:53522009-53522031 TCCCAAACTTGGCTCCTCCCTGG - Intergenic
932086785 2:68769684-68769706 TGCCAGACTTAGTTGCTCCCTGG - Intronic
934624397 2:95834985-95835007 TGACAGATTTGGATTCTCCCTGG - Intergenic
934828239 2:97490427-97490449 TGACAGATTTGGATTCTCCCTGG - Intergenic
935150928 2:100434922-100434944 TCCCAAACCTGGCTGCTCACTGG - Intergenic
936464420 2:112734574-112734596 AGCCAAACTTGGCATCTCCCTGG - Intronic
937337345 2:121070127-121070149 GGACAAATTGGGCTGCTCTCAGG - Intergenic
940089585 2:149900597-149900619 TTACAAACTTTGCTGCACCTGGG - Intergenic
1169281801 20:4274112-4274134 TGACAAAAATGGCAGCTCCAGGG - Intergenic
1174666225 20:52260489-52260511 TCTCAAACTTGGCTGCCCACTGG - Intergenic
1174937902 20:54892695-54892717 AGAGAAACTTTGCTGATCCCTGG + Intergenic
1176252145 20:64130461-64130483 TGGCAATCCTGGATGCTCCCTGG - Intergenic
1178201079 21:30405925-30405947 TGACAATGTTCGATGCTCCCTGG + Intronic
1178498801 21:33109346-33109368 TCCCAAACTTGGCTGCACACTGG - Intergenic
1183771129 22:39926945-39926967 TGACAAACTGGGCTGGATCCAGG - Intronic
949476656 3:4453127-4453149 TTACAAACTTGCGTGCTTCCTGG - Intronic
950491703 3:13309214-13309236 TCACAAACATGGATGCTGCCAGG - Intergenic
950704744 3:14772882-14772904 TGGCTCACTTGGCTGCTGCCAGG - Exonic
951917985 3:27821963-27821985 CGGCCATCTTGGCTGCTCCCCGG + Intergenic
953201227 3:40780312-40780334 AGTCAGACTTGGCTGCTGCCTGG + Intergenic
955008144 3:54988869-54988891 TGACATACTTGCTTGCTCTCAGG + Intronic
959179673 3:102962722-102962744 GGACCAACTTTGCTGCTCCTTGG + Intergenic
959370734 3:105522094-105522116 TCACTAACTGTGCTGCTCCCTGG - Intronic
968000224 3:195200545-195200567 TGACCAACTTGGCTCCTCCCAGG + Intronic
974060553 4:57030252-57030274 TTAAAAACTGGGCTGCTCCATGG - Exonic
974410304 4:61532670-61532692 TGAATCCCTTGGCTGCTCCCAGG - Intronic
975679154 4:76858440-76858462 TGACAAATCTGGCAGTTCCCTGG + Intergenic
976515885 4:85965759-85965781 TCACAACCTTGGCTGCACACTGG - Intronic
979580067 4:122347606-122347628 TGACTGACTTGGCTGCTCCCAGG - Exonic
983506101 4:168555489-168555511 TGAGAAAACTTGCTGCTCCCTGG + Intronic
985129615 4:186726610-186726632 TGACAAACTTGGCTGCTCCCGGG - Intronic
985239593 4:187916494-187916516 TCACAGACTCGGCTGCTCACTGG + Intergenic
987281109 5:16414418-16414440 TCACAAACATGGCAGCTCCTGGG - Intergenic
992497462 5:77307887-77307909 TGGCAAACTTGGCCACTTCCTGG + Intronic
993385239 5:87254405-87254427 TGACAAACTTTCCTGCCCCCTGG - Intergenic
994583942 5:101682251-101682273 AGAGCAATTTGGCTGCTCCCTGG + Intergenic
996413879 5:123188314-123188336 TGATAAAATTAGCTGCTCCTGGG - Exonic
996961811 5:129259718-129259740 TGACAAACTTGTATTCTTCCAGG + Intergenic
998049954 5:139023909-139023931 AGACAAATTTGGCTTCTGCCAGG + Intronic
998868272 5:146527653-146527675 TGGCAATCTTTGGTGCTCCCTGG + Intergenic
1000688699 5:164287396-164287418 TGAAAACCTGGGCAGCTCCCTGG + Intergenic
1002092559 5:176813678-176813700 GGCCAAAGTTGGCTGCTCCTGGG - Intronic
1003435863 6:6087418-6087440 TGGCAACCTTGGCTCTTCCCTGG + Intergenic
1006485927 6:34341886-34341908 TGCCACACTTGGCTCCTCCTCGG + Exonic
1007401178 6:41603276-41603298 GGACAAACTTGCCTGTTTCCGGG + Intergenic
1009554504 6:65145649-65145671 TGACAAATTTGACAACTCCCAGG + Intronic
1010438279 6:75861424-75861446 TGACAAACTTGCCTGGAGCCTGG - Intronic
1011418708 6:87150604-87150626 TGACAAACTTGGAAATTCCCAGG - Intergenic
1012549908 6:100456655-100456677 TGATAAATTTTGCTTCTCCCAGG + Intronic
1014392166 6:120876046-120876068 AGAAAAACTTGGCTGCTTCAAGG - Intergenic
1015145022 6:129976113-129976135 TAACAAAATGGGCTCCTCCCAGG + Intergenic
1017432533 6:154385145-154385167 GGACAAACATTCCTGCTCCCAGG - Intronic
1020760300 7:12261020-12261042 TGCCAATCTTGTCTGCTCCTAGG - Intergenic
1022685016 7:32589163-32589185 TGACAAACTTCCTTGCCCCCTGG + Intergenic
1023073427 7:36459962-36459984 TGAGAAACTTGACTTCTCCAAGG - Intergenic
1027234681 7:76291333-76291355 TGCCATCCTTGGCTCCTCCCAGG + Intergenic
1029255453 7:99266504-99266526 TCACAAAGGGGGCTGCTCCCAGG + Intergenic
1030896078 7:115061856-115061878 TGAAAATCATGGCTGCTGCCAGG - Intergenic
1032405067 7:131649968-131649990 TGGCTGTCTTGGCTGCTCCCTGG + Intergenic
1032995851 7:137445717-137445739 AGACAAGCTTGCCTGCTCCTAGG + Intronic
1037232975 8:16681916-16681938 TGACAAACTTTGGTGTTCCTTGG + Intergenic
1039207926 8:35177488-35177510 CGGCCATCTTGGCTGCTCCCCGG + Intergenic
1041244343 8:55876458-55876480 TCCCAAACTTGGCTGCTCATTGG + Intergenic
1044807183 8:96020492-96020514 TGACAGATTTGGCTGCTGCATGG - Intergenic
1046309965 8:112422529-112422551 TGACAAGCTTTGCTACTTCCTGG + Intronic
1046891359 8:119424829-119424851 TGACAAACTGGGCTGCACACTGG + Intergenic
1046961642 8:120119959-120119981 TGAAAAACTTGGCTGCTGTTAGG + Intronic
1047686597 8:127311574-127311596 TGGCCATCTTGGCTCCTCCCCGG - Intergenic
1048591438 8:135824451-135824473 TTACAATCTTAGCTGCACCCTGG + Intergenic
1052373310 9:27690518-27690540 TGGCCATCTTGGCTCCTCCCCGG - Intergenic
1055944038 9:81676781-81676803 TGTCAAACCTGGCCGCACCCTGG - Intronic
1057369348 9:94455973-94455995 TTACAAACTTTTCTTCTCCCTGG - Intronic
1057721027 9:97532062-97532084 GACCAAACTTGGCTGCTTCCTGG - Intronic
1059490164 9:114660161-114660183 TGACATTCCTTGCTGCTCCCCGG - Intergenic
1060861612 9:126959453-126959475 TGGCAAACGTGGCTTCTCTCAGG + Intronic
1189232121 X:39460675-39460697 TGACACCCTTGAGTGCTCCCTGG - Intergenic
1190251990 X:48733837-48733859 TGGCAATCTTTGCTGTTCCCTGG - Intergenic
1191200833 X:57779523-57779545 TGACAAACTTGGGTTTTCCAAGG + Intergenic
1193003359 X:76587970-76587992 TGACCAAGTTGGCTTCACCCTGG - Intergenic
1193099937 X:77598494-77598516 AGATAAACTTGGCTGGTCTCAGG - Intronic
1194238598 X:91415292-91415314 TGGCAAGCTTGGCTGCTCTAAGG + Intergenic
1195845972 X:109229113-109229135 TGCCTAACTCGGCAGCTCCCAGG + Intergenic
1196640232 X:118051170-118051192 TTACAAACTTTGCTGCTCTCAGG - Intronic
1196817625 X:119677688-119677710 TGACAAAGTTGGCTGCTGAGAGG - Intronic