ID: 985129615

View in Genome Browser
Species Human (GRCh38)
Location 4:186726610-186726632
Sequence TGACAAACTTGGCTGCTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985129615_985129627 26 Left 985129615 4:186726610-186726632 CCCGGGAGCAGCCAAGTTTGTCA 0: 1
1: 0
2: 2
3: 10
4: 136
Right 985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
985129615_985129622 11 Left 985129615 4:186726610-186726632 CCCGGGAGCAGCCAAGTTTGTCA 0: 1
1: 0
2: 2
3: 10
4: 136
Right 985129622 4:186726644-186726666 GGCAGCCAGCCGCCGAGTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 79
985129615_985129619 -10 Left 985129615 4:186726610-186726632 CCCGGGAGCAGCCAAGTTTGTCA 0: 1
1: 0
2: 2
3: 10
4: 136
Right 985129619 4:186726623-186726645 AAGTTTGTCAGGACGTGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 46
985129615_985129624 19 Left 985129615 4:186726610-186726632 CCCGGGAGCAGCCAAGTTTGTCA 0: 1
1: 0
2: 2
3: 10
4: 136
Right 985129624 4:186726652-186726674 GCCGCCGAGTTGAGGAGTTGCGG 0: 1
1: 0
2: 0
3: 9
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985129615 Original CRISPR TGACAAACTTGGCTGCTCCC GGG (reversed) Intronic