ID: 985129616

View in Genome Browser
Species Human (GRCh38)
Location 4:186726611-186726633
Sequence CTGACAAACTTGGCTGCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985129616_985129622 10 Left 985129616 4:186726611-186726633 CCGGGAGCAGCCAAGTTTGTCAG 0: 1
1: 0
2: 1
3: 7
4: 135
Right 985129622 4:186726644-186726666 GGCAGCCAGCCGCCGAGTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 79
985129616_985129627 25 Left 985129616 4:186726611-186726633 CCGGGAGCAGCCAAGTTTGTCAG 0: 1
1: 0
2: 1
3: 7
4: 135
Right 985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
985129616_985129624 18 Left 985129616 4:186726611-186726633 CCGGGAGCAGCCAAGTTTGTCAG 0: 1
1: 0
2: 1
3: 7
4: 135
Right 985129624 4:186726652-186726674 GCCGCCGAGTTGAGGAGTTGCGG 0: 1
1: 0
2: 0
3: 9
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985129616 Original CRISPR CTGACAAACTTGGCTGCTCC CGG (reversed) Intronic
900500074 1:3000017-3000039 CTTACAAACTGATCTGCTCCCGG - Intergenic
904310541 1:29626580-29626602 CTGTCAATCTTAGCTGCTCTGGG - Intergenic
904927120 1:34057974-34057996 CTGGCAGGCTTGGCTTCTCCTGG + Intronic
905425827 1:37883661-37883683 CTCACAAACTAGGATGCTGCAGG + Intronic
907992974 1:59600784-59600806 CTGACAAACTTGGATATTTCTGG - Intronic
908160247 1:61400397-61400419 CTGACACTCTCTGCTGCTCCTGG + Intronic
915169365 1:153967377-153967399 AAGACAAACCTGGCTGCTCAGGG + Intronic
922613819 1:226949021-226949043 CTGACCAGCTGGGCTGCTCCAGG - Intronic
924521971 1:244813464-244813486 CTGTCCAGCTTAGCTGCTCCAGG - Intergenic
1063250742 10:4271306-4271328 CAGACACACTTAGCTGCTGCAGG + Intergenic
1067015723 10:42755252-42755274 TTGCCATACTTGGCTGCTGCCGG - Intergenic
1069743416 10:70699904-70699926 CACACAAACCTGGCTGGTCCAGG - Intronic
1072659749 10:97356519-97356541 CTGACACAGGTGGGTGCTCCCGG + Intronic
1073793807 10:106966045-106966067 CTGGAGAACTTGGCTGCTGCCGG + Intronic
1074924641 10:118055266-118055288 CTGATAAACTAGGGTCCTCCAGG + Intergenic
1079450582 11:20597341-20597363 CGCACAGACTTGGCTGCCCCGGG - Intergenic
1080051749 11:27865210-27865232 CAGACAAACTTTGATGCTCAGGG + Intergenic
1085277073 11:75307154-75307176 CTTATAAACTTGGCTGCTGTGGG - Intronic
1086553452 11:88081467-88081489 CTGACAGGGTTGGCTCCTCCTGG + Intergenic
1087167158 11:95016455-95016477 CTGACAAAATTGGGAGGTCCAGG + Intergenic
1088141718 11:106624583-106624605 CTGATACAATTGGCTTCTCCTGG + Intergenic
1089583841 11:119497672-119497694 CACACAGACTTTGCTGCTCCGGG + Intergenic
1090928499 11:131274137-131274159 CTGATAAATTTGGGTGCCCCTGG + Intergenic
1091003603 11:131932004-131932026 CTGACAGCCCTGGCTGCTCTGGG - Intronic
1091145119 11:133272846-133272868 CGTAGAAACTTGGCTTCTCCGGG - Intronic
1095882790 12:47156281-47156303 TTGACAATGTTGGCTGCTGCTGG + Intronic
1096871740 12:54596920-54596942 CTCACCAGCTTGGCTTCTCCAGG - Intergenic
1098437590 12:70484435-70484457 CTGACCCATTTGGGTGCTCCAGG + Intergenic
1098923828 12:76327674-76327696 ACGACAAACTAAGCTGCTCCTGG + Intergenic
1099015324 12:77337266-77337288 CCGACCAACTTGGCTGATCATGG + Intergenic
1100386008 12:94105150-94105172 CTGAAAAACATGGCTGAGCCGGG + Intergenic
1100438980 12:94598028-94598050 CTGATAAACTTGAATGATCCTGG - Intronic
1104606577 12:130193777-130193799 CTGTCACCCTTGCCTGCTCCAGG - Intergenic
1105779768 13:23695982-23696004 CTGACAAACCTGCCTCCCCCGGG + Intergenic
1107483153 13:40802078-40802100 CTGGCAAACTTGGCAGATCCTGG + Intronic
1114369081 14:22065674-22065696 TTGACAAACTTGCCTGCCTCTGG - Intergenic
1115695798 14:35897718-35897740 CTGACAGGCTTGCCTGCTCTTGG + Intronic
1124686284 15:31785558-31785580 CTGACCAACTTGGAAGCTACTGG + Intronic
1125361940 15:38873671-38873693 ATGACAATCTTGGCTTCCCCAGG + Intergenic
1126013308 15:44324939-44324961 CTGTCTAGCGTGGCTGCTCCAGG - Intronic
1128367753 15:67016588-67016610 CTGACATACTTGGGTGCTTTGGG - Intergenic
1128393922 15:67203906-67203928 TTGAGAAACTTAGCTACTCCTGG - Intronic
1132997488 16:2830705-2830727 CTGAAATACTTGCCTCCTCCAGG - Exonic
1137894327 16:52194755-52194777 CTGACAAACTTTGCTGCTCTCGG + Intergenic
1139400089 16:66674397-66674419 GTGACCATCTGGGCTGCTCCTGG - Intronic
1139558456 16:67727385-67727407 CTGGCCAACTGGGCAGCTCCAGG + Exonic
1139897057 16:70295963-70295985 CTGATAACCATGGCTGCCCCTGG - Intronic
1141820496 16:86442261-86442283 CTGGCCATCTGGGCTGCTCCAGG - Intergenic
1143166490 17:4899650-4899672 CTCACAAACACGGCTTCTCCTGG + Exonic
1143649958 17:8257264-8257286 CTGAGAAACTTGGCTGGGCGTGG + Intronic
1145066080 17:19762261-19762283 CTGTCCAACATGGCTGCTCCAGG - Intergenic
1149043060 17:52213009-52213031 CTGACATTCTTGACTGCTCCTGG - Intergenic
1151203161 17:72483742-72483764 CTGAAGAACTTTGCTGATCCTGG - Intergenic
1152231711 17:79117229-79117251 CTAACACACTGGGCTGCTCCAGG - Intronic
1152877944 17:82798687-82798709 CAGAGGAACATGGCTGCTCCTGG - Intronic
1158718785 18:59904853-59904875 CTGGCATCCTTGACTGCTCCTGG + Intergenic
1160151230 18:76395845-76395867 CTGAAACACTTGGCTCCTGCAGG - Intronic
1165179176 19:33953118-33953140 CTGCGAAACTTGGCTGATGCAGG - Intergenic
1165929191 19:39345006-39345028 CTAACAAATGTGGCTGCTGCTGG - Intronic
1165945767 19:39441324-39441346 CTGAGACTCTAGGCTGCTCCAGG + Intronic
1166204376 19:41259589-41259611 CTGTAAAACTTGGCCGGTCCTGG - Exonic
1166234615 19:41446531-41446553 CTGACCATCTTGGCTGTCCCTGG - Intergenic
1167190989 19:47989562-47989584 CTGTCCCACTTGACTGCTCCTGG + Intronic
1168019032 19:53595311-53595333 CTGACACCCTCGGCTGCACCTGG - Intergenic
1168077589 19:53990001-53990023 CTCCCACAGTTGGCTGCTCCAGG - Exonic
925717992 2:6802546-6802568 CTGAAAATCTTGACTACTCCAGG - Intergenic
926138995 2:10357292-10357314 CTGACAACCTGGGCTGGGCCAGG - Intronic
926762546 2:16291764-16291786 CGGAGAAACTTGGTTGCCCCAGG + Intergenic
936456911 2:112682234-112682256 CTGAGATGCTTGGCTGCGCCTGG - Intergenic
938288158 2:130135825-130135847 CAGACAATGTTGGCTGATCCTGG - Intergenic
940089586 2:149900598-149900620 TTTACAAACTTTGCTGCACCTGG - Intergenic
944981974 2:205131764-205131786 CTGTCAAACTGGGCTGCTTACGG - Intronic
1169281802 20:4274113-4274135 ATGACAAAAATGGCAGCTCCAGG - Intergenic
1172313356 20:33934641-33934663 CTGAAGAACTTGGATGCTCAAGG - Intergenic
1172607026 20:36220865-36220887 CTCATCAACCTGGCTGCTCCAGG - Intronic
1173661039 20:44733885-44733907 CTGACAAACTTGGTTGCAAGTGG + Intergenic
1175295536 20:57906433-57906455 CAGACAAACTTGGCTTCTCTGGG + Intergenic
1175812139 20:61864162-61864184 CCGTCCAACTTGGGTGCTCCTGG - Intronic
1179464052 21:41559735-41559757 TTCTCAAACTTGGCTGCCCCTGG - Intergenic
1181107704 22:20584701-20584723 CAGACAATGTTGGCTGATCCTGG - Intronic
1183726576 22:39593210-39593232 CAGACAATCTGGGCTGCTCGGGG + Intronic
1184745595 22:46453902-46453924 CTAACAACCCCGGCTGCTCCTGG - Intronic
951647604 3:24910607-24910629 CAGTCTAACTTGGGTGCTCCTGG + Intergenic
951982447 3:28580622-28580644 CTGAAAAACATTCCTGCTCCAGG + Intergenic
953403402 3:42646899-42646921 CTGCCAATCCTGCCTGCTCCAGG - Exonic
956162897 3:66373423-66373445 CTCACAAGCTCAGCTGCTCCTGG - Intronic
957018948 3:75101859-75101881 CTCACTCACTTGGCTACTCCTGG + Intergenic
961537349 3:127578084-127578106 CTGAGAAACTGGGCAGTTCCTGG - Intronic
962037719 3:131670421-131670443 ATCACAAACTTGGCTAATCCTGG + Intronic
964636185 3:158860371-158860393 GTGACAACCTTGGCATCTCCAGG + Intergenic
966852290 3:184171557-184171579 CCGAAATTCTTGGCTGCTCCAGG - Exonic
971101827 4:23475182-23475204 CTGACAATCTTTGCTGTACCTGG + Intergenic
978978962 4:114918208-114918230 CTGACAAAATGGGCTCCTCATGG + Intronic
980778043 4:137462087-137462109 CTGACACACATGGCTCCACCTGG + Intergenic
982698343 4:158630133-158630155 CTGAGAAACGTTCCTGCTCCTGG - Intronic
985129616 4:186726611-186726633 CTGACAAACTTGGCTGCTCCCGG - Intronic
987207541 5:15643074-15643096 GTGAAAACCTTGGCTGCTCATGG - Intronic
987281110 5:16414419-16414441 GTCACAAACATGGCAGCTCCTGG - Intergenic
987605422 5:20128626-20128648 CTGACAAACTCAACTGTTCCTGG - Intronic
988260018 5:28874277-28874299 CTGACAGACTTGCCTGGTACAGG + Intergenic
992170640 5:74098247-74098269 TTGACAAGCATGACTGCTCCAGG - Intergenic
992356280 5:75987203-75987225 CTAACAAATTTGCCTGCTACTGG - Intergenic
996413880 5:123188315-123188337 TTGATAAAATTAGCTGCTCCTGG - Exonic
997165955 5:131660419-131660441 CTGACACCCTTGGCTCCACCTGG + Intronic
997670909 5:135671253-135671275 GTGACAAACTTCCCAGCTCCAGG - Intergenic
998050860 5:139033283-139033305 CTGACAAACATGGCTGGGCACGG - Intronic
999400085 5:151257745-151257767 CAAAGAAGCTTGGCTGCTCCAGG - Intronic
1000978358 5:167789495-167789517 CAGCCAAGTTTGGCTGCTCCTGG + Intronic
1002092560 5:176813679-176813701 AGGCCAAAGTTGGCTGCTCCTGG - Intronic
1002314383 5:178333749-178333771 CTGAGGAAGTGGGCTGCTCCTGG + Intronic
1006619972 6:35357027-35357049 CTGAGAAACATAACTGCTCCAGG - Intronic
1008975481 6:57420604-57420626 CTAACAATCTTAGCTGGTCCTGG + Intronic
1011397883 6:86929245-86929267 CTGTCAGACTTGGCTTCTGCTGG - Intergenic
1012858226 6:104528132-104528154 CTGACAACCATCCCTGCTCCAGG - Intergenic
1015376606 6:132516923-132516945 CTGAAGAACTTGGATGCTCAGGG - Intergenic
1022482150 7:30751412-30751434 CTGACTCACCTGGCTACTCCGGG - Intronic
1022502891 7:30893648-30893670 CTGATAAACAAGGCTGCTGCTGG - Intergenic
1024225181 7:47321085-47321107 CTGGCACAATTGGCTCCTCCTGG - Intronic
1024587766 7:50856337-50856359 CTGACAAAGTTGGCTGCCCTGGG + Intergenic
1024827549 7:53409514-53409536 CTGCCACAATAGGCTGCTCCAGG + Intergenic
1027350753 7:77308922-77308944 CTGAAACAGTTGGCTGCCCCTGG - Intronic
1031079983 7:117249010-117249032 CTGAGAAAGCTGGCTGCTACAGG + Intergenic
1031486731 7:122335808-122335830 CTGTCATACTTGTCTACTCCAGG - Intronic
1033583113 7:142754181-142754203 CTGTCTCCCTTGGCTGCTCCTGG - Intronic
1033584658 7:142765086-142765108 CTGTCTTCCTTGGCTGCTCCTGG - Intergenic
1033586131 7:142775654-142775676 CTGTCTCCCTTGGCTGCTCCTGG - Intergenic
1036149717 8:6286190-6286212 CTCACAGCCTTGGCTCCTCCAGG - Intergenic
1036614248 8:10376125-10376147 CTGACAATCTGAGCTGCTCATGG + Intronic
1043910045 8:85853764-85853786 CTGAAATAATTGGCTGCTTCTGG + Intergenic
1050786318 9:9406710-9406732 CTGACAAAGTTGGATGCTTGAGG + Intronic
1052901876 9:33800318-33800340 CTGTCTCCCTTGGCTGCTCCTGG - Intergenic
1053177812 9:35941568-35941590 CTGAAAAACCTTGCTGCTCAGGG + Intergenic
1055711992 9:79073574-79073596 CTGACACTCTTGTCTCCTCCTGG + Intergenic
1056517442 9:87368587-87368609 CTAACAACCTTGGCTTCCCCAGG + Intergenic
1056954077 9:91068572-91068594 CTGACACCATTGGCTGCCCCGGG - Intergenic
1060066428 9:120505140-120505162 CTGACAGACTTGGTTGATGCAGG - Intronic
1061861548 9:133471013-133471035 CTGGCAACCTTGGCTGGTTCGGG + Intergenic
1062005788 9:134237809-134237831 CTGAACAACTTGGCCACTCCTGG + Intergenic
1062130412 9:134889710-134889732 CTGAAAGACTTGGCTCCTTCAGG + Intergenic
1188104676 X:26135499-26135521 CTTCCAAACATGGCTGATCCTGG - Intergenic
1189628072 X:42920899-42920921 CTGGCAAGCCTTGCTGCTCCAGG + Intergenic
1189953747 X:46257879-46257901 CTGACACCCTTGGCTCCACCTGG - Intergenic
1195560135 X:106273835-106273857 CTGATAAACGTGTATGCTCCTGG + Intergenic
1195561827 X:106292504-106292526 CTGATAAACGTGTATGCTCCTGG - Intergenic