ID: 985129616

View in Genome Browser
Species Human (GRCh38)
Location 4:186726611-186726633
Sequence CTGACAAACTTGGCTGCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985129616_985129624 18 Left 985129616 4:186726611-186726633 CCGGGAGCAGCCAAGTTTGTCAG 0: 1
1: 0
2: 1
3: 7
4: 135
Right 985129624 4:186726652-186726674 GCCGCCGAGTTGAGGAGTTGCGG 0: 1
1: 0
2: 0
3: 9
4: 65
985129616_985129627 25 Left 985129616 4:186726611-186726633 CCGGGAGCAGCCAAGTTTGTCAG 0: 1
1: 0
2: 1
3: 7
4: 135
Right 985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
985129616_985129622 10 Left 985129616 4:186726611-186726633 CCGGGAGCAGCCAAGTTTGTCAG 0: 1
1: 0
2: 1
3: 7
4: 135
Right 985129622 4:186726644-186726666 GGCAGCCAGCCGCCGAGTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985129616 Original CRISPR CTGACAAACTTGGCTGCTCC CGG (reversed) Intronic