ID: 985129618

View in Genome Browser
Species Human (GRCh38)
Location 4:186726621-186726643
Sequence TGGGCACGTCCTGACAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985129618_985129628 21 Left 985129618 4:186726621-186726643 CCAAGTTTGTCAGGACGTGCCCA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 985129628 4:186726665-186726687 GGAGTTGCGGCCGCCGGCTGCGG 0: 1
1: 0
2: 0
3: 10
4: 150
985129618_985129622 0 Left 985129618 4:186726621-186726643 CCAAGTTTGTCAGGACGTGCCCA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 985129622 4:186726644-186726666 GGCAGCCAGCCGCCGAGTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 79
985129618_985129627 15 Left 985129618 4:186726621-186726643 CCAAGTTTGTCAGGACGTGCCCA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
985129618_985129624 8 Left 985129618 4:186726621-186726643 CCAAGTTTGTCAGGACGTGCCCA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 985129624 4:186726652-186726674 GCCGCCGAGTTGAGGAGTTGCGG 0: 1
1: 0
2: 0
3: 9
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985129618 Original CRISPR TGGGCACGTCCTGACAAACT TGG (reversed) Intronic
905894212 1:41534625-41534647 TGGGGATGTCCTGACAAATGAGG - Intronic
912658494 1:111508205-111508227 TGGAGACCTCCTGACACACTCGG - Intronic
915305321 1:154974028-154974050 TGGGGACTTCCAGAAAAACTGGG + Intronic
916094239 1:161334378-161334400 TGGGCCCGTCCTAATAATCTAGG + Intronic
919819848 1:201465991-201466013 TGGGCATGTCCTGAGAGTCTGGG + Exonic
920897798 1:210075139-210075161 TGGCCTCGTCCAGCCAAACTTGG + Intronic
1072986644 10:100146630-100146652 AAGGCAGGTTCTGACAAACTGGG - Intergenic
1074578847 10:114696887-114696909 TAGGCACATCCTGAGATACTGGG + Intergenic
1077025974 11:440071-440093 TGGGCACGCCCTGAGAATCAGGG + Intronic
1079586368 11:22130230-22130252 TGGGCAGGGCCTCCCAAACTGGG + Intergenic
1084383562 11:68828542-68828564 TGGGCACACCCTGCCAGACTGGG + Intronic
1089197291 11:116701685-116701707 TGGGCCCCTCCAGACAAGCTGGG - Intergenic
1097234802 12:57532074-57532096 TGGTCAGCTCCTGACACACTTGG - Exonic
1100699337 12:97129633-97129655 TGGGCACTCCCTGAAATACTTGG - Intergenic
1105241263 13:18610996-18611018 TGGCCACCTCCTGAGAACCTGGG - Intergenic
1110535362 13:76645264-76645286 TGGGCACAGCCTGACCAAGTTGG - Intergenic
1115585359 14:34806394-34806416 TGGGCACGTGCTTAAAACCTGGG - Intronic
1116939686 14:50778735-50778757 CAGGCACGTCCTGACACACTCGG + Intronic
1117061048 14:51964340-51964362 TGAACAAGTCCTCACAAACTGGG - Intronic
1122269170 14:100560668-100560690 TGGCCACTTCCTGGCAAACCCGG + Intronic
1123490092 15:20774151-20774173 TGGCCACCTCCTGAGAACCTGGG + Intergenic
1123546593 15:21343238-21343260 TGGCCACCTCCTGAGAACCTGGG + Intergenic
1124532319 15:30518424-30518446 GGGGGACGACCTGGCAAACTCGG + Intergenic
1124766334 15:32489221-32489243 GGGGGACGACCTGGCAAACTCGG - Intergenic
1129503388 15:76060506-76060528 GGGGCACCTCCCGACAAACGGGG - Intronic
1202954923 15_KI270727v1_random:70453-70475 TGGCCACCTCCTGAGAACCTGGG + Intergenic
1136584272 16:31173840-31173862 TGGGACCATCCTGACAAACATGG + Intergenic
1137071441 16:35908024-35908046 TGGGTGCGTCCTGAAAAATTAGG + Intergenic
1140799814 16:78476051-78476073 GGGGCAATTCCTGTCAAACTGGG - Intronic
1143068486 17:4268633-4268655 AGGGCTCTTCCTTACAAACTCGG - Intergenic
1145747500 17:27331383-27331405 TGGGCATGTCCTCACAAGTTGGG + Intergenic
1148524612 17:48319426-48319448 TGGGAACATAATGACAAACTTGG + Intronic
1148858346 17:50591316-50591338 TGGGCACGTCGAGAGAAAATGGG - Intronic
1154447694 18:14448905-14448927 TGGCCACCTCCTGAGAACCTGGG + Intergenic
1155972215 18:32092830-32092852 TGAGCACCTCCTGACAGACGGGG - Exonic
1156960705 18:43026351-43026373 TGAGAACGTCCTGACCAACATGG + Intronic
1158617135 18:58998486-58998508 AGGGAACATTCTGACAAACTGGG + Intergenic
1160543967 18:79640724-79640746 AGGGCACCTCCGGAGAAACTGGG + Intergenic
1165383876 19:35499119-35499141 TGGGCACGTACTGACCAAGGGGG + Intronic
927990634 2:27444488-27444510 TCAGCACGTCCTGGCACACTGGG + Exonic
934102645 2:88667476-88667498 TGGGCACATCCTGACATGCCAGG - Intergenic
934714346 2:96535020-96535042 TGGGCACATTCTGACAGACAAGG - Intergenic
937027431 2:118711202-118711224 TGGGCACCTCCTGATACAGTGGG - Intergenic
942232641 2:173874248-173874270 TGGCCACGTACTGACATACATGG + Intergenic
948642113 2:239382143-239382165 GGTGCAGGTCCTGACTAACTTGG - Intronic
1175537225 20:59722985-59723007 TGGGCAGGCCCTGACCATCTTGG + Intronic
1182341839 22:29628932-29628954 TGGGCAAGATCTCACAAACTTGG - Intronic
953563730 3:44013811-44013833 TGAGCACCTCCTCACAAACATGG + Intergenic
959557539 3:107739433-107739455 TGGGCAGGTCCAGCCAAAGTGGG - Intronic
966365225 3:179178606-179178628 TGGGAACCTCCTGACACATTAGG - Intronic
970523720 4:16910959-16910981 TTAGCACATCTTGACAAACTAGG + Intergenic
983628344 4:169825812-169825834 TGGGCAGGGCCTCTCAAACTGGG - Intergenic
984580822 4:181508192-181508214 TGGGCACTTGCTGACAACCCAGG - Intergenic
984748565 4:183249040-183249062 TGGACAAATCCTGACATACTTGG - Intronic
985129618 4:186726621-186726643 TGGGCACGTCCTGACAAACTTGG - Intronic
985845752 5:2345862-2345884 TGGGCAGGTCCTCCCAACCTGGG - Intergenic
986862796 5:11947854-11947876 TGGCCACATTCTGACATACTAGG + Intergenic
990409793 5:55530816-55530838 TGAGCACCTCCTGACAGACGGGG + Intronic
991447815 5:66718683-66718705 AGAGCACATCCAGACAAACTTGG - Intronic
996128949 5:119757801-119757823 TTGGAACTTCTTGACAAACTGGG + Intergenic
1009589806 6:65653056-65653078 TGGACATGTCCTGAAAAAGTGGG + Intronic
1009888749 6:69655791-69655813 TGGGCAGGACCTCTCAAACTGGG + Intergenic
1011371020 6:86636434-86636456 TGGTCAAGTCCTGATAAAGTGGG + Intergenic
1013194555 6:107833664-107833686 TGGGCCCTTTCTCACAAACTGGG - Intergenic
1015240849 6:131021814-131021836 TGGGTTCGTCCTTACCAACTAGG - Intronic
1021004931 7:15382457-15382479 TGGGCATGTCCTGAAAAATGAGG + Intronic
1022031846 7:26498934-26498956 TGAGAACGCCCTGACAAACATGG + Intergenic
1036425781 8:8644140-8644162 AGGTCACGTCCTGACATATTGGG + Intergenic
1037838202 8:22227016-22227038 TGGGGACGTCCTGAGAAACAGGG + Exonic
1040490020 8:47911405-47911427 TTGGCAGCTCCTGATAAACTAGG - Intronic
1048817644 8:138348877-138348899 TGGGCACGTGTTGACAAACCTGG - Intronic
1195823230 X:108969915-108969937 TGGGCAAGCCCTGCCACACTGGG + Intergenic
1198012524 X:132572821-132572843 TGGCCAAGTCCTGAGATACTTGG - Intergenic
1198524878 X:137491082-137491104 TGGTTACATCCTGACATACTAGG - Intergenic
1202169489 Y:22026411-22026433 TGGGCCCATCCTGACTAACACGG - Intergenic
1202221876 Y:22559961-22559983 TGGGCCCATCCTGACTAACACGG + Intergenic
1202321242 Y:23635713-23635735 TGGGCCCATCCTGACTAACACGG - Intergenic
1202549525 Y:26034343-26034365 TGGGCCCATCCTGACTAACACGG + Intergenic