ID: 985129620

View in Genome Browser
Species Human (GRCh38)
Location 4:186726640-186726662
Sequence AACTCGGCGGCTGGCTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985129620_985129627 -4 Left 985129620 4:186726640-186726662 CCCAGGCAGCCAGCCGCCGAGTT 0: 1
1: 0
2: 0
3: 8
4: 94
Right 985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
985129620_985129628 2 Left 985129620 4:186726640-186726662 CCCAGGCAGCCAGCCGCCGAGTT 0: 1
1: 0
2: 0
3: 8
4: 94
Right 985129628 4:186726665-186726687 GGAGTTGCGGCCGCCGGCTGCGG 0: 1
1: 0
2: 0
3: 10
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985129620 Original CRISPR AACTCGGCGGCTGGCTGCCT GGG (reversed) Intronic
901322180 1:8346461-8346483 AACGTGGCGGGTGGCTGGCTCGG - Intergenic
902530018 1:17085015-17085037 ACCTCAGCAGCTGACTGCCTGGG - Intronic
902892428 1:19453967-19453989 GACGCTGCAGCTGGCTGCCTGGG - Intronic
907512059 1:54969197-54969219 ATCTAGATGGCTGGCTGCCTTGG + Intergenic
912388039 1:109282378-109282400 TGCTGGGCGGCTGGCTGACTCGG - Intronic
917118274 1:171623942-171623964 GACTCGGCGCCTGGTTACCTCGG - Intergenic
922542438 1:226429394-226429416 ACACCGGCGGCTGCCTGCCTGGG - Intergenic
923242468 1:232099063-232099085 AACTCAGCACCTGGCTGCCTTGG + Intergenic
1064236992 10:13585491-13585513 AACACAACGGCTGGCTACCTGGG - Intergenic
1066306801 10:34152981-34153003 AACTAGGCAGATGGCTGACTTGG + Intronic
1067382607 10:45788915-45788937 AGCTAGGCGGCTGGCTGCTCAGG + Exonic
1067890311 10:50129463-50129485 AGCTAGGCGGCTGGCTGCTCAGG + Exonic
1078636248 11:13053121-13053143 AACTTCTAGGCTGGCTGCCTTGG - Intergenic
1080536489 11:33226933-33226955 AATTAGGAGGCTGGGTGCCTTGG + Intergenic
1081570407 11:44287098-44287120 GCCTCGGCGGATGCCTGCCTCGG - Intronic
1090964527 11:131586441-131586463 AACATGGCAGCTGGCTCCCTGGG - Intronic
1091558418 12:1593459-1593481 AGCGCGGCGGAGGGCTGCCTGGG - Exonic
1095405284 12:41861086-41861108 AACTGGGCAGATGCCTGCCTTGG + Intergenic
1095501158 12:42839901-42839923 AGCTGGGAGGCTGGCAGCCTGGG - Intergenic
1097151011 12:56979829-56979851 AACTCAGCTGATGCCTGCCTGGG - Intergenic
1098756077 12:74365137-74365159 AACTAGAAGGCAGGCTGCCTGGG + Intergenic
1117090202 14:52242312-52242334 AACTCTGCCTCTGCCTGCCTTGG - Intergenic
1122153657 14:99737907-99737929 CCCTCGGCGACTGGCGGCCTTGG - Intronic
1123416965 15:20101722-20101744 GCCTCGGTGGCTGGCTGGCTTGG + Intergenic
1123448034 15:20343829-20343851 AGCTGGGTGGCTGGCTGCCTTGG - Intergenic
1123526304 15:21108828-21108850 GCCTCGGTGGCTGGCTGGCTTGG + Intergenic
1124182533 15:27490351-27490373 TATTTGGAGGCTGGCTGCCTAGG + Intronic
1128928313 15:71679458-71679480 AACTTGGCGGCTGGCTTTTTTGG - Intronic
1129101335 15:73267023-73267045 ACCTCGGGGTCTGCCTGCCTTGG - Intronic
1129854972 15:78817131-78817153 AACTTGGAGGCTGGGTGCCCTGG + Intronic
1133632924 16:7638881-7638903 AACATGGTGGCTGGCTGCTTGGG + Intronic
1135133067 16:19868605-19868627 AGCTTGGAGGCTGGCTCCCTGGG - Intronic
1135768590 16:25199049-25199071 AACATGGTGGCTGGCAGCCTCGG + Intergenic
1138552466 16:57755084-57755106 AACTCAGCGGTTGCCGGCCTGGG - Intronic
1141765127 16:86053079-86053101 AACAAGGCAGATGGCTGCCTGGG + Intergenic
1142336076 16:89490301-89490323 AACGCGGCCGCGGGCTGCATGGG - Exonic
1145978525 17:28998021-28998043 CACTCAGCAGGTGGCTGCCTGGG + Intronic
1150628491 17:66859055-66859077 AGCTGAGCGCCTGGCTGCCTGGG - Intronic
1151472256 17:74325835-74325857 AGGGCGGCGGCTGGCAGCCTCGG - Intergenic
1152742977 17:82026481-82026503 CACCCAGCGGCTGGCTGCTTGGG - Intronic
1156499821 18:37550648-37550670 AGCCCGTCCGCTGGCTGCCTGGG + Intronic
1161261527 19:3340462-3340484 ACCTCGGAGGCTGGCTCCCTGGG + Intergenic
1161333558 19:3699504-3699526 GACGCTGCTGCTGGCTGCCTGGG + Intronic
1162907072 19:13830460-13830482 GACGCGGCGGCCGGCGGCCTGGG + Exonic
1163624161 19:18379051-18379073 GGCTCAGCGGCTGGCTGCTTGGG + Intronic
1163665868 19:18603932-18603954 TAGCGGGCGGCTGGCTGCCTGGG - Intronic
1163817194 19:19474028-19474050 AACTGGGTGGCTGGATGTCTAGG - Intronic
1168694949 19:58398790-58398812 AACTCTGCGGCTGTCTGACCAGG - Intergenic
925351337 2:3202975-3202997 CACTCGGTGTCTGGCTGCCGAGG + Intronic
930740995 2:54832423-54832445 GTCTTGGAGGCTGGCTGCCTGGG + Intronic
948502624 2:238406426-238406448 ACCTCGGCGGTTGGCTGGCGGGG + Intergenic
1168781410 20:494259-494281 AACTCGTCATCTGCCTGCCTTGG + Intronic
1169044576 20:2525250-2525272 GACTCGGCGGCCGGCAGCCTGGG - Intergenic
1170599233 20:17828406-17828428 AACTCCGGGGCTGGCTGCTGAGG - Intergenic
1172637520 20:36419939-36419961 ATCTTGGAGGCTGGCTGCCATGG + Intronic
1174559201 20:51417870-51417892 AGCTGGCAGGCTGGCTGCCTCGG - Intronic
1176084342 20:63289278-63289300 CTCTCGGGGGCTGGCTTCCTGGG - Exonic
1176369245 21:6052572-6052594 ACCTGTGCTGCTGGCTGCCTTGG + Intergenic
1179754274 21:43485969-43485991 ACCTGTGCTGCTGGCTGCCTTGG - Intergenic
1180963570 22:19773860-19773882 AACTCGGCGGCTGAGGGCCGAGG - Intronic
1183520319 22:38293074-38293096 ACCTCGGAGGCTGCCTGACTTGG - Intronic
1183625954 22:39001864-39001886 AACTCTGCAGCCGGCTGCCTGGG + Intergenic
1183935901 22:41262082-41262104 GACTTGGCAGCTGGCTCCCTTGG - Intronic
954258823 3:49424296-49424318 AACTCTTCTGCTGCCTGCCTAGG - Exonic
954466775 3:50659829-50659851 AACTCTGGGGCTGGCTGCTACGG + Intergenic
954625709 3:52020950-52020972 GACACGGCCGCTGGCTGCCCGGG - Intergenic
955687770 3:61562877-61562899 AAGTCGGAGGCTGGCTGCGGAGG + Intronic
959983663 3:112548118-112548140 ACCTCGTCATCTGGCTGCCTCGG - Intronic
960672528 3:120167100-120167122 TACTGGGGGGCTGGCTTCCTGGG - Exonic
963086665 3:141443376-141443398 ACCTCTGCGGCTGGCGGCCCGGG - Exonic
970186572 4:13460711-13460733 AACTCAGCCACTGGTTGCCTTGG - Exonic
972676205 4:41261938-41261960 AAATCGGAGCCAGGCTGCCTGGG + Intronic
973070865 4:45856571-45856593 AACTGGGAGGCTGGTAGCCTGGG - Intergenic
975457336 4:74607661-74607683 AACTTGGCGGCTGGGTGCCATGG - Intergenic
985129620 4:186726640-186726662 AACTCGGCGGCTGGCTGCCTGGG - Intronic
986941323 5:12953840-12953862 AACTCAGCTGATGCCTGCCTTGG + Intergenic
988595416 5:32585950-32585972 AATGCGGCGGCGGCCTGCCTAGG + Intronic
995225162 5:109692624-109692646 AACTCAGTGGCTGGGAGCCTGGG - Intronic
998699474 5:144681580-144681602 AGCTGGGCGTATGGCTGCCTCGG - Intergenic
1001316437 5:170644308-170644330 CACTCGGCTGCTGACTGCCTCGG - Intronic
1002496466 5:179616174-179616196 CACTCAGCTGCTGGCTGGCTGGG + Exonic
1004859940 6:19793340-19793362 AACTCTGAGGCTGGATGCCGTGG - Intergenic
1004892720 6:20116904-20116926 AACTCATGGACTGGCTGCCTTGG - Intronic
1005290109 6:24371314-24371336 AACTAGGAGGCTGGATGCCGTGG + Intergenic
1006148968 6:31976109-31976131 GACGGGGCGGCTGGCTGCGTGGG + Intronic
1012475760 6:99613665-99613687 AACTCGGCGGCGGGCGGCGCGGG + Exonic
1017914172 6:158819071-158819093 AACGCGGAGCCTGGGTGCCTGGG - Intronic
1019641753 7:2107066-2107088 CACTCAGCACCTGGCTGCCTGGG + Intronic
1019684772 7:2375280-2375302 AACGCCGAGGCTGGCTCCCTGGG + Intronic
1031510125 7:122638787-122638809 AGCTGGGCAGCTGCCTGCCTGGG - Intronic
1039419208 8:37421444-37421466 AGCTGGGTGGCTGGCTGCCTGGG + Intergenic
1048676018 8:136781106-136781128 AACTTGGGGTCTGGCTGGCTGGG - Intergenic
1049242029 8:141542893-141542915 AAGTTGGCTGCTGGGTGCCTGGG + Intergenic
1052894546 9:33734987-33735009 AGCTGGGCGGCTGGTAGCCTGGG + Intergenic
1053289196 9:36868820-36868842 ATCTCGGAGGCAGGCTGACTGGG - Intronic
1054823011 9:69543002-69543024 TACTCTGCAGCTGGCTGGCTGGG - Intronic
1056636107 9:88332609-88332631 AACTCGTGATCTGGCTGCCTCGG + Intergenic
1057210376 9:93198106-93198128 CACTCAGCCCCTGGCTGCCTGGG - Intronic
1061565104 9:131433455-131433477 AACACAGGGCCTGGCTGCCTGGG + Intronic
1062208824 9:135352101-135352123 GAGTCTGCGGGTGGCTGCCTGGG + Intergenic
1062694000 9:137863121-137863143 ACCTCGGCATCTGCCTGCCTTGG + Intronic
1190070143 X:47272828-47272850 AACTCTTCTGCTGCCTGCCTAGG - Intergenic
1195232021 X:102859654-102859676 ACCTCGGAGGCTGGTAGCCTGGG - Intergenic