ID: 985129621

View in Genome Browser
Species Human (GRCh38)
Location 4:186726641-186726663
Sequence CAACTCGGCGGCTGGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985129621_985129628 1 Left 985129621 4:186726641-186726663 CCAGGCAGCCAGCCGCCGAGTTG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 985129628 4:186726665-186726687 GGAGTTGCGGCCGCCGGCTGCGG 0: 1
1: 0
2: 0
3: 10
4: 150
985129621_985129627 -5 Left 985129621 4:186726641-186726663 CCAGGCAGCCAGCCGCCGAGTTG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985129621 Original CRISPR CAACTCGGCGGCTGGCTGCC TGG (reversed) Intronic
903938779 1:26914359-26914381 CAGCTCTGGGGCTGGCTTCCTGG - Intronic
907251120 1:53140549-53140571 TAACCCCGCTGCTGGCTGCCTGG - Intronic
909603098 1:77481084-77481106 CAGTTCGGTGGCTGGGTGCCTGG + Intronic
910277454 1:85464673-85464695 CAACACGGCGGCCGGCGGCGGGG + Intronic
913975218 1:143450341-143450363 CACCTCGGCGACTGCCTTCCAGG + Intergenic
914069611 1:144275957-144275979 CACCTCGGCGACTGCCTTCCAGG + Intergenic
914109544 1:144690397-144690419 CACCTCGGCGACTGCCTTCCAGG - Intergenic
921317455 1:213905598-213905620 ACTCTCGGCTGCTGGCTGCCCGG - Intergenic
922098830 1:222465436-222465458 CAACTCGGCTGCTGGCTAACAGG + Intergenic
922542439 1:226429395-226429417 CACACCGGCGGCTGCCTGCCTGG - Intergenic
923029009 1:230232001-230232023 CAACAGGGGAGCTGGCTGCCAGG - Intronic
923675779 1:236079751-236079773 CCACTCACCGGCTGGCTCCCAGG - Intergenic
1079987212 11:27211956-27211978 CAACTAGCCAGCTGGCTTCCTGG + Intergenic
1084704671 11:70809214-70809236 CAACAGGGCGCCTGGCTGCAGGG + Intronic
1087994878 11:104793098-104793120 CAAGTTGGGGGCTGGTTGCCAGG + Intergenic
1090611461 11:128474721-128474743 CATCTCAGCTGCTGGCTGACAGG + Intronic
1090964528 11:131586442-131586464 CAACATGGCAGCTGGCTCCCTGG - Intronic
1091207840 11:133833322-133833344 GAACACTGCGTCTGGCTGCCGGG + Intergenic
1091558419 12:1593460-1593482 CAGCGCGGCGGAGGGCTGCCTGG - Exonic
1095501159 12:42839902-42839924 CAGCTGGGAGGCTGGCAGCCTGG - Intergenic
1095841393 12:46697548-46697570 CAACTTGATGGCTGGCTGGCTGG - Intergenic
1096241360 12:49961870-49961892 CCACTCCGAGGCTGGCGGCCTGG - Exonic
1105972152 13:25439225-25439247 CAACTCAGGGGCTGTCAGCCAGG + Intronic
1118289224 14:64504614-64504636 CCACTCTGCCGCTGGCTGCTAGG - Intronic
1126227988 15:46293707-46293729 CAAATCAGCAGCTGCCTGCCTGG + Intergenic
1129193626 15:73951892-73951914 CCCCTCGGCGGGAGGCTGCCCGG - Exonic
1129364942 15:75048462-75048484 CAGCTGGGCTGCTGGCTGCAGGG + Intronic
1130540673 15:84818801-84818823 CAACAAGGCCCCTGGCTGCCAGG + Intronic
1134163977 16:11915627-11915649 CGACTCGGCGCCTGACTGCTGGG - Exonic
1135133068 16:19868606-19868628 CAGCTTGGAGGCTGGCTCCCTGG - Intronic
1144656433 17:17040167-17040189 CAACTCAGAGGCAGCCTGCCCGG - Intergenic
1148899937 17:50867534-50867556 CAACGAGGCGATTGGCTGCCTGG + Intronic
1150628492 17:66859056-66859078 CAGCTGAGCGCCTGGCTGCCTGG - Intronic
1152007244 17:77690381-77690403 CATCTGGGTGGCTGTCTGCCAGG + Intergenic
1155166239 18:23234714-23234736 CAACTTGGTGACTGGCAGCCTGG - Intronic
1155494329 18:26427924-26427946 CAGCTCGTGGGGTGGCTGCCTGG - Intergenic
1156499820 18:37550647-37550669 CAGCCCGTCCGCTGGCTGCCTGG + Intronic
1161261526 19:3340461-3340483 GACCTCGGAGGCTGGCTCCCTGG + Intergenic
1167763073 19:51461654-51461676 CAACTCTGGGGCTTCCTGCCGGG + Intergenic
925854553 2:8117051-8117073 CAGCTCTGAGGATGGCTGCCCGG + Intergenic
928635492 2:33241515-33241537 CAGCCTTGCGGCTGGCTGCCAGG - Intronic
932567672 2:72919933-72919955 CAACTCGGCCCCTGGGCGCCAGG - Intronic
934179918 2:89611314-89611336 CACCTCGGCGACTGCCTTCCAGG + Intergenic
934290214 2:91685575-91685597 CACCTCGGCGACTGCCTTCCAGG + Intergenic
947385753 2:229588428-229588450 CAGCTCTGCGGGTGGCCGCCTGG - Exonic
948464963 2:238147925-238147947 CTTCTCGGCTGCCGGCTGCCGGG + Exonic
948502623 2:238406425-238406447 CACCTCGGCGGTTGGCTGGCGGG + Intergenic
1169044577 20:2525251-2525273 GGACTCGGCGGCCGGCAGCCTGG - Intergenic
1169187631 20:3632072-3632094 TAACCTGGAGGCTGGCTGCCAGG - Intronic
1169695996 20:8387155-8387177 CAACTGGGCGGCTGACTGCTTGG + Intronic
1173425871 20:42943166-42943188 CAACTCGGCTTCTGTCTGCCTGG - Intronic
1174558476 20:51413048-51413070 AAACCCGGGAGCTGGCTGCCTGG - Intronic
1175544725 20:59770958-59770980 CACCTCAGGGGCAGGCTGCCAGG - Intronic
1180990539 22:19933129-19933151 GCACTCAGAGGCTGGCTGCCAGG - Intronic
1183073294 22:35411226-35411248 ACACTAGGCGGCTGCCTGCCTGG - Intronic
1183625953 22:39001863-39001885 CAACTCTGCAGCCGGCTGCCTGG + Intergenic
954625710 3:52020951-52020973 TGACACGGCCGCTGGCTGCCCGG - Intergenic
955406288 3:58627606-58627628 CAACTGGGCAGCAGGCTGCCTGG + Exonic
960672529 3:120167101-120167123 CTACTGGGGGGCTGGCTTCCTGG - Exonic
963086666 3:141443377-141443399 AACCTCTGCGGCTGGCGGCCCGG - Exonic
963283658 3:143412174-143412196 CTCCTCTGCTGCTGGCTGCCAGG + Intronic
968965780 4:3768393-3768415 CTAGTCGGGGGGTGGCTGCCAGG + Exonic
968968130 4:3779691-3779713 CAGCTCGGGCGCTGGCTCCCCGG + Intergenic
969232663 4:5842483-5842505 CAACTCAAAGGATGGCTGCCAGG + Intronic
969829365 4:9782316-9782338 CACCTCGGCGACTGCCTTCCAGG - Exonic
972676204 4:41261937-41261959 CAAATCGGAGCCAGGCTGCCTGG + Intronic
973070866 4:45856572-45856594 CAACTGGGAGGCTGGTAGCCTGG - Intergenic
985129621 4:186726641-186726663 CAACTCGGCGGCTGGCTGCCTGG - Intronic
988778238 5:34496382-34496404 AATCTCGGGAGCTGGCTGCCAGG + Intergenic
995225163 5:109692625-109692647 CAACTCAGTGGCTGGGAGCCTGG - Intronic
998168801 5:139860026-139860048 CACCTCGCAGGATGGCTGCCCGG - Intronic
999262317 5:150245548-150245570 CAACCCGAGGTCTGGCTGCCTGG + Intronic
1000209250 5:159095895-159095917 GAACTTGGCGTCTGGCTTCCAGG - Intronic
1002496465 5:179616173-179616195 CCACTCAGCTGCTGGCTGGCTGG + Exonic
1012475759 6:99613664-99613686 GAACTCGGCGGCGGGCGGCGCGG + Exonic
1019347229 7:537145-537167 CAACATGGCGGCTGGCATCCCGG + Intergenic
1027650382 7:80859791-80859813 CAGCTCAGTGGCTGGCTGGCTGG + Intronic
1032834637 7:135661887-135661909 CGTCTCCTCGGCTGGCTGCCTGG + Intergenic
1033406142 7:141073113-141073135 CACCTGGGCGGCAGGCTCCCGGG + Intergenic
1037882022 8:22578249-22578271 CCACTTGGCCTCTGGCTGCCAGG - Intergenic
1039149763 8:34490893-34490915 CAACTCTGTGGCTAGCTGACAGG - Intergenic
1039419207 8:37421443-37421465 GAGCTGGGTGGCTGGCTGCCTGG + Intergenic
1040593827 8:48819292-48819314 CATCCCAGCGGCAGGCTGCCTGG - Intergenic
1047162347 8:122394803-122394825 CAGCTAGCTGGCTGGCTGCCAGG + Intergenic
1047343652 8:124006439-124006461 CAACTCAGCTGCTGCCTCCCTGG - Intronic
1048676019 8:136781107-136781129 CAACTTGGGGTCTGGCTGGCTGG - Intergenic
1049242028 8:141542892-141542914 CAAGTTGGCTGCTGGGTGCCTGG + Intergenic
1052894545 9:33734986-33735008 CAGCTGGGCGGCTGGTAGCCTGG + Intergenic
1053289197 9:36868821-36868843 CATCTCGGAGGCAGGCTGACTGG - Intronic
1057210377 9:93198107-93198129 CCACTCAGCCCCTGGCTGCCTGG - Intronic
1061204109 9:129153127-129153149 CACCTCCGGTGCTGGCTGCCTGG - Intergenic
1189363650 X:40371657-40371679 CACCTCAGGGGCTGGCTTCCCGG + Intergenic
1195232022 X:102859655-102859677 CACCTCGGAGGCTGGTAGCCTGG - Intergenic