ID: 985129622

View in Genome Browser
Species Human (GRCh38)
Location 4:186726644-186726666
Sequence GGCAGCCAGCCGCCGAGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 79}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985129614_985129622 23 Left 985129614 4:186726598-186726620 CCGGAACGAGGGCCCGGGAGCAG 0: 1
1: 0
2: 0
3: 4
4: 120
Right 985129622 4:186726644-186726666 GGCAGCCAGCCGCCGAGTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 79
985129616_985129622 10 Left 985129616 4:186726611-186726633 CCGGGAGCAGCCAAGTTTGTCAG 0: 1
1: 0
2: 1
3: 7
4: 135
Right 985129622 4:186726644-186726666 GGCAGCCAGCCGCCGAGTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 79
985129615_985129622 11 Left 985129615 4:186726610-186726632 CCCGGGAGCAGCCAAGTTTGTCA 0: 1
1: 0
2: 2
3: 10
4: 136
Right 985129622 4:186726644-186726666 GGCAGCCAGCCGCCGAGTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 79
985129618_985129622 0 Left 985129618 4:186726621-186726643 CCAAGTTTGTCAGGACGTGCCCA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 985129622 4:186726644-186726666 GGCAGCCAGCCGCCGAGTTGAGG 0: 1
1: 0
2: 0
3: 8
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985129622 Original CRISPR GGCAGCCAGCCGCCGAGTTG AGG Intronic