ID: 985129627

View in Genome Browser
Species Human (GRCh38)
Location 4:186726659-186726681
Sequence AGTTGAGGAGTTGCGGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 55}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985129620_985129627 -4 Left 985129620 4:186726640-186726662 CCCAGGCAGCCAGCCGCCGAGTT 0: 1
1: 0
2: 0
3: 8
4: 94
Right 985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
985129616_985129627 25 Left 985129616 4:186726611-186726633 CCGGGAGCAGCCAAGTTTGTCAG 0: 1
1: 0
2: 1
3: 7
4: 135
Right 985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
985129621_985129627 -5 Left 985129621 4:186726641-186726663 CCAGGCAGCCAGCCGCCGAGTTG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
985129618_985129627 15 Left 985129618 4:186726621-186726643 CCAAGTTTGTCAGGACGTGCCCA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
985129615_985129627 26 Left 985129615 4:186726610-186726632 CCCGGGAGCAGCCAAGTTTGTCA 0: 1
1: 0
2: 2
3: 10
4: 136
Right 985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985129627 Original CRISPR AGTTGAGGAGTTGCGGCCGC CGG Intronic