ID: 985129627

View in Genome Browser
Species Human (GRCh38)
Location 4:186726659-186726681
Sequence AGTTGAGGAGTTGCGGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 55}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985129616_985129627 25 Left 985129616 4:186726611-186726633 CCGGGAGCAGCCAAGTTTGTCAG 0: 1
1: 0
2: 1
3: 7
4: 135
Right 985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
985129621_985129627 -5 Left 985129621 4:186726641-186726663 CCAGGCAGCCAGCCGCCGAGTTG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
985129618_985129627 15 Left 985129618 4:186726621-186726643 CCAAGTTTGTCAGGACGTGCCCA 0: 1
1: 0
2: 0
3: 3
4: 74
Right 985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
985129615_985129627 26 Left 985129615 4:186726610-186726632 CCCGGGAGCAGCCAAGTTTGTCA 0: 1
1: 0
2: 2
3: 10
4: 136
Right 985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 55
985129620_985129627 -4 Left 985129620 4:186726640-186726662 CCCAGGCAGCCAGCCGCCGAGTT 0: 1
1: 0
2: 0
3: 8
4: 94
Right 985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG 0: 1
1: 0
2: 1
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985129627 Original CRISPR AGTTGAGGAGTTGCGGCCGC CGG Intronic
903173102 1:21565609-21565631 AGATGAGGAGGGGGGGCCGCAGG + Intronic
905674756 1:39817602-39817624 AGTGGAGGAGCTGCGGCTACGGG + Intergenic
905861533 1:41355235-41355257 AGTTGAGGAGGTGGTGACGCTGG + Intergenic
1063609725 10:7552413-7552435 AATTGAAGAGTTGTGGCCACAGG + Intergenic
1069445669 10:68471514-68471536 AGTTGAGGAGTTTCGGCCACTGG - Intronic
1083996476 11:66275568-66275590 TGTTGAGGTGTTGGGGCAGCTGG + Intronic
1084411568 11:69009065-69009087 CGCTGTGGAGTGGCGGCCGCAGG - Intronic
1086759214 11:90606098-90606120 AGGTGAGGAGTTGAGGCAGGAGG + Intergenic
1090206543 11:124887443-124887465 AGCTGAGGAGTTTCGGTCCCAGG + Exonic
1093081551 12:14817476-14817498 AGTTGAGGAGTGGGGGGCGAGGG - Intronic
1095907328 12:47391646-47391668 AGGTGGGGAGTGGCGGCCACAGG - Intergenic
1104811299 12:131621883-131621905 AGTGCAGGAGCTGCGGCAGCAGG - Intergenic
1114476446 14:22998537-22998559 GATTGAGGAGCTGCGGCAGCTGG - Exonic
1116345910 14:43793669-43793691 AGTTTAGAAGTTGCAGCCCCTGG + Intergenic
1122384808 14:101337107-101337129 ATTTGAGGAGTTGCTGTGGCCGG + Intergenic
1125727059 15:41873554-41873576 GGTGGAGGAGAAGCGGCCGCTGG - Exonic
1125882901 15:43209156-43209178 AGATGGGGAAATGCGGCCGCAGG + Intronic
1139459495 16:67110327-67110349 AGGTGAGGAGCTGCGGGCGCAGG - Intronic
1144473251 17:15563117-15563139 AGTTGAGGAGGAGCGGCCTGCGG - Intronic
1144923231 17:18781603-18781625 AGTTGAGGAGGAGCGGCCTGCGG + Intronic
1146738226 17:35258110-35258132 AGTTGAGGAGCTGAGTCTGCTGG - Intronic
1152747937 17:82049799-82049821 AGCTGAGCAGGTGCGGCTGCCGG - Exonic
1153527284 18:6009224-6009246 AGTCCAGGAGTTGGGGCCTCAGG + Intronic
1159428896 18:68325421-68325443 AGGAGAGGAGTTGCTGCTGCTGG - Intergenic
1160406784 18:78651797-78651819 AGGTGGGGAGCTGGGGCCGCTGG + Intergenic
1161613737 19:5258036-5258058 AGGTGAGGAGTAGCGCACGCCGG + Exonic
1161979627 19:7623811-7623833 TGTTGAGGAGCAGGGGCCGCCGG + Exonic
1166592445 19:44012191-44012213 AGTTGAGGACTTGAGGCCTGAGG - Exonic
1167430495 19:49451484-49451506 ATTTGAGGAGCTGCTGCTGCAGG - Exonic
925678002 2:6386541-6386563 AGTTGGGGAATTGAGGCTGCTGG - Intergenic
925865065 2:8220099-8220121 AGATGAGGAGCTGCACCCGCTGG + Intergenic
927981947 2:27380053-27380075 GGTTAAGGATTAGCGGCCGCTGG - Intronic
932733009 2:74233630-74233652 AGTTGAGGAGGTGGGACAGCAGG - Intronic
1173744712 20:45427355-45427377 AGATGAGAAGTTGCTGCCTCCGG + Intergenic
1176117267 20:63438549-63438571 TGTTGAGGAGTGGAGGCCGCTGG - Intronic
1180874382 22:19168378-19168400 AGGTGAGTAGGTGGGGCCGCGGG - Intergenic
1184100488 22:42339515-42339537 AAGTGAGGAGTTGGGGCAGCTGG + Intronic
949609600 3:5690926-5690948 ATTGGAGGTGTTGCTGCCGCTGG + Intergenic
953980364 3:47410379-47410401 AATTGAGGAGGTGGGGCCGAGGG - Exonic
955276996 3:57556296-57556318 AGCTGAGGAGCCGAGGCCGCCGG - Exonic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985628956 5:1005035-1005057 GGAGGAGGAGGTGCGGCCGCAGG - Intergenic
991487885 5:67156744-67156766 AGTGAAGGGGTTGAGGCCGCAGG + Intronic
997971408 5:138405427-138405449 AGCTGAGAGGTTGAGGCCGCAGG + Intronic
1005873463 6:29994545-29994567 AGCTGAGGAGTTGCTGGAGCTGG - Intergenic
1007609376 6:43139358-43139380 AGACGAGGAATTGGGGCCGCTGG - Intronic
1016741200 6:147530742-147530764 AGTTGAGGAATTGCGGGACCAGG + Intronic
1017883836 6:158582194-158582216 ATTTGAGGAGGTGCCGCCGTGGG + Intronic
1018122315 6:160647286-160647308 AGCTGAGGAGTTTGGGCTGCGGG + Intronic
1019162981 6:170081204-170081226 AGGGGAGGAGCTGCAGCCGCAGG + Intergenic
1026942501 7:74295336-74295358 AGTTGAGAAGCTGGGGCAGCAGG + Intronic
1036750112 8:11438323-11438345 AGCTGATGAGTTGGGGCTGCTGG - Intronic
1037306603 8:17511095-17511117 GGTTGAGGAGTTGGGGGCGAGGG + Intronic
1047998529 8:130358425-130358447 CGCTGAGGAGCTGCCGCCGCCGG - Intronic
1053427159 9:38017664-38017686 AGTGGTGGAGTAGCGGCAGCGGG - Intronic
1057410314 9:94811751-94811773 AGCTGAGGAGATGCCGCCTCTGG - Intronic
1060985090 9:127815227-127815249 AGTTCAGGTGTGGAGGCCGCAGG + Exonic
1061539770 9:131271839-131271861 AGTTGAGGAATTGCGGGGGCCGG + Intronic
1192185774 X:68946005-68946027 GGTTGAGGAATGGCGGCAGCCGG - Intergenic
1196889054 X:120274959-120274981 AGTTGAGGAGATGGGACCTCAGG - Intronic