ID: 985129750

View in Genome Browser
Species Human (GRCh38)
Location 4:186727172-186727194
Sequence ATTCACATCCAGAAGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985129750_985129753 11 Left 985129750 4:186727172-186727194 CCCTCCAACTTCTGGATGTGAAT No data
Right 985129753 4:186727206-186727228 ACTTATTATTATGCTCTTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985129750 Original CRISPR ATTCACATCCAGAAGTTGGA GGG (reversed) Intergenic
No off target data available for this crispr